TALEN

TALEN2-nr5a2

ID
ZDB-TALEN-170828-1
Name
TALEN2-nr5a2
Previous Names
None
Target
Target Sequence 1
5' - CCAGTGTGCGGAGACAAGGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Target Sequence 2
5' - CTCACAGGTCAGCAACCC - 3'
ZFIN BLAST NCBI BLAST Ensembl
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb193 nr5a2
ihb195 nr5a2
Expression
Gene expression in Wild Types + TALEN2-nr5a2
No data available
Phenotype
Phenotype resulting from TALEN2-nr5a2
No data available
Phenotype of all Fish created by or utilizing TALEN2-nr5a2
Phenotype Fish Conditions Figures
liver ccne2 expression decreased amount, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 4 from Zhai et al., 2017
pancreas ccne2 expression decreased amount, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 4 from Zhai et al., 2017
intestine decreased size, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 2 from Zhai et al., 2017
liver decreased size, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 1,  Fig. 2,  Fig. 6 from Zhai et al., 2017
digestion decreased rate, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 2 from Zhai et al., 2017
intestine ccnd1 expression decreased amount, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 4 from Zhai et al., 2017
whole organism viability, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 1 from Zhai et al., 2017
liver ccnd1 expression decreased amount, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 4 from Zhai et al., 2017
pancreas ccnd1 expression decreased amount, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 4 from Zhai et al., 2017
pancreas myca expression decreased amount, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 4 from Zhai et al., 2017
digestive system G1/S transition of mitotic cell cycle delayed, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 3 from Zhai et al., 2017
pancreas decreased size, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 2 from Zhai et al., 2017
liver decreased size, abnormal nr5a2ihb193/ihb193 chemical treatment: phosphatidylcholine Fig. 6 from Zhai et al., 2017
liver myca expression decreased amount, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 4 from Zhai et al., 2017
digestive system cell population proliferation disrupted, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 3 from Zhai et al., 2017
intestine ccne2 expression decreased amount, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 4 from Zhai et al., 2017
intestine myca expression decreased amount, abnormal nr5a2ihb193/ihb193 standard conditions Fig. 4 from Zhai et al., 2017
liver ccne2 expression decreased amount, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 4 from Zhai et al., 2017
pancreas ccne2 expression decreased amount, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 4 from Zhai et al., 2017
liver decreased size, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 1,  Fig. 2 from Zhai et al., 2017
intestine decreased size, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 2 from Zhai et al., 2017
digestion decreased rate, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 2 from Zhai et al., 2017
intestine ccnd1 expression decreased amount, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 4 from Zhai et al., 2017
whole organism viability, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 1 from Zhai et al., 2017
liver ccnd1 expression decreased amount, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 4 from Zhai et al., 2017
pancreas ccnd1 expression decreased amount, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 4 from Zhai et al., 2017
pancreas myca expression decreased amount, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 4 from Zhai et al., 2017
digestive system G1/S transition of mitotic cell cycle delayed, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 3 from Zhai et al., 2017
pancreas decreased size, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 2 from Zhai et al., 2017
intestine ccne2 expression decreased amount, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 4 from Zhai et al., 2017
digestive system cell population proliferation disrupted, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 3 from Zhai et al., 2017
intestine myca expression decreased amount, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 4 from Zhai et al., 2017
liver myca expression decreased amount, abnormal nr5a2ihb195/ihb195 standard conditions Fig. 4 from Zhai et al., 2017
liver decreased size, abnormal nr5a2ihb193/ihb193; gz15Tg standard conditions Fig. 2 from Zhai et al., 2017
exocrine pancreas decreased size, abnormal nr5a2ihb193/ihb193; gz15Tg standard conditions Fig. 2 from Zhai et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.