TALEN

TALEN2-rac2

ID

ZDB-TALEN-170410-2

Name

TALEN2-rac2

Previous Names

None

Target

rac2 (1)

Target Sequence 1

5' - TCCAATTATCCTGGTTGGCAC - 3'

Target Sequence 2

5' - TCGATGGTCTCCTTCTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 3

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uwm31	rac2
uwm32	rac2

Expression

Gene expression in Wild Types + TALEN2-rac2

No data available

Phenotype

Phenotype resulting from TALEN2-rac2

No data available

Phenotype of all Fish created by or utilizing TALEN2-rac2

Phenotype	Fish	Conditions	Figures
neutrophil migration decreased occurrence, abnormal	rac2^uwm31/uwm31	transection: caudal fin	Fig. 2 from Rosowski et al., 2016
whole organism decreased life span, abnormal	rac2^uwm32/uwm32	standard conditions	Fig. 1 from Rosowski et al., 2016
neutrophil migration decreased occurrence, abnormal	rac2^uwm32/uwm32	transection: caudal fin	Fig. 5 from Rosowski et al., 2016
whole organism decreased life span, exacerbated	rac2^uwm32/uwm32	fungal treatment by injection: Aspergillus fumigatus	Fig. 4 from Rosowski et al., 2016
whole organism decreased life span, abnormal	rac2^uwm32/uwm32	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 6 from Rosowski et al., 2016
neutrophil migration decreased occurrence, abnormal	rac2^uwm32/uwm32	transection: caudal fin	Fig. 2 from Rosowski et al., 2016
whole organism decreased life span, abnormal	rac2^uwm32/uwm32	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 5 from Rosowski et al., 2016
neutrophil decreased amount, abnormal	rac2^uwm32/uwm32	control	Fig. 5 from Rosowski et al., 2016
macrophage defense response to fungus decreased process quality, abnormal	rac2^uwm32/uwm32	fungal treatment by injection: Aspergillus fumigatus	Fig 5 from Tanner et al., 2024
defense response to fungus decreased efficacy, exacerbated	rac2^uwm32/uwm32	fungal treatment by injection: Aspergillus fumigatus	Fig. 4 from Rosowski et al., 2016
whole organism decreased size, abnormal	rac2^uwm32/uwm32	standard conditions	Fig. 1 from Rosowski et al., 2016
defense response to bacterium decreased efficacy, abnormal	rac2^uwm32/uwm32	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 5 from Rosowski et al., 2016
whole organism decreased length, abnormal	rac2^uwm32/uwm32	standard conditions	Fig. 1 from Rosowski et al., 2016
macrophage detection of fungus decreased process quality, abnormal	rac2^uwm32/uwm32	fungal treatment by injection: Aspergillus fumigatus	Fig 3 from Tanner et al., 2024
otic vesicle neutrophil decreased amount, abnormal	rac2^uwm32/uwm32	control	Fig. 5 from Rosowski et al., 2016
defense response to bacterium decreased efficacy, abnormal	rac2^uwm32/uwm32	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 6 from Rosowski et al., 2016
neutrophil migration decreased occurrence, exacerbated	rac2^uwm32/uwm32	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 5 from Rosowski et al., 2016
whole organism viability, abnormal	rac2^uwm32/uwm32	fungal treatment by injection: Aspergillus fumigatus	Fig 1 from Tanner et al., 2024
response to fungus process quality, abnormal	rac2^uwm32/uwm32	fungal treatment by injection: Aspergillus fumigatus	Fig 1 from Tanner et al., 2024
whole organism decreased life span, exacerbated	rac2^uwm32/uwm32	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 4 from Rosowski et al., 2016
defense response to bacterium decreased efficacy, exacerbated	rac2^uwm32/uwm32	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 4 from Rosowski et al., 2016
fin broken, abnormal	rac2^uwm32/uwm32	standard conditions	Fig. 1 from Rosowski et al., 2016
whole organism decreased life span, abnormal	rac2^uwm32/+	fungal treatment by injection: Aspergillus fumigatus	Fig. 4 from Rosowski et al., 2016
defense response to fungus decreased efficacy, abnormal	rac2^uwm32/+	fungal treatment by injection: Aspergillus fumigatus	Fig. 4 from Rosowski et al., 2016
neutrophil migration decreased occurrence, abnormal	rac2^uwm32/+	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 5 from Rosowski et al., 2016
whole organism decreased life span, abnormal	rac2^uwm32/+	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 4 from Rosowski et al., 2016
defense response to bacterium decreased efficacy, abnormal	rac2^uwm32/+	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 4 from Rosowski et al., 2016
neutrophil migration decreased occurrence, abnormal	rac2^uwm32/uwm32; uwm7Tg	transection: caudal fin	Fig. 2 from Rosowski et al., 2016
trunk neutrophil decreased amount, abnormal	rac2^uwm32/uwm32; uwm7Tg	control	Fig. 3 from Rosowski et al., 2016
pericardium neutrophil increased amount, abnormal	rac2^uwm32/uwm32; uwm7Tg	control	Fig. 3 from Rosowski et al., 2016
neutrophil decreased amount, abnormal	rac2^uwm32/uwm32; uwm7Tg	control	Fig. 3 from Rosowski et al., 2016
neutrophil decreased velocity, abnormal	rac2^uwm32/uwm32; uwm7Tg	transection: caudal fin	Fig. 2 from Rosowski et al., 2016
macrophage migration decreased occurrence, abnormal	rac2^uwm32/uwm32; uwm7Tg	transection: caudal fin	Fig. 7 from Rosowski et al., 2016
head neutrophil decreased amount, abnormal	rac2^uwm32/uwm32; uwm7Tg	control	Fig. 3 from Rosowski et al., 2016
whole organism decreased life span, ameliorated	rac2^uwm32/uwm32; uwm7Tg	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 6 from Rosowski et al., 2016
otic vesicle macrophage decreased amount, abnormal	rac2^uwm32/uwm32; uwm12Tg	transection: caudal fin	Fig. 7 from Rosowski et al., 2016
macrophage migration decreased occurrence, abnormal	rac2^uwm32/uwm32; uwm12Tg	transection: caudal fin	Fig. 7 from Rosowski et al., 2016
macrophage decreased velocity, abnormal	rac2^uwm32/uwm32; uwm12Tg	transection: caudal fin	Fig. 7 from Rosowski et al., 2016
macrophage migration decreased occurrence, abnormal	rac2^uwm32/uwm32; uwm12Tg	transection: caudal fin	Fig. 7 from Rosowski et al., 2016
macrophage detection of fungus decreased process quality, abnormal	rac2^uwm32/uwm32; xt12Tg/xt12Tg	fungal treatment by injection: Aspergillus fumigatus	Fig 2 from Tanner et al., 2024
circulating cell neutrophil increased amount, abnormal	rac2^uwm32/uwm32; uwm7Tg; zf307Tg	control	Fig. 3 from Rosowski et al., 2016
macrophage migration decreased occurrence, abnormal	rac2^uwm32/uwm32; uwm12Tg; zf306Tg	transection: caudal fin	Fig. 7 from Rosowski et al., 2016
macrophage migration occurrence, ameliorated	rac2^uwm32/uwm32; uwm27Tg	transection: caudal fin	Fig. 7 from Rosowski et al., 2016
macrophage defense response to fungus decreased process quality, ameliorated	rac2^uwm32/uwm32; uwm27Tg/uwm27Tg	fungal treatment by injection: Aspergillus fumigatus	Fig 5 from Tanner et al., 2024
whole organism decreased life span, ameliorated	rac2^uwm32/uwm32; uwm28Tg	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 5 from Rosowski et al., 2016
defense response to bacterium process efficacy, ameliorated	rac2^uwm32/uwm32; uwm28Tg	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 5 from Rosowski et al., 2016
neutrophil migration occurrence, ameliorated	rac2^uwm32/uwm32; uwm28Tg	transection: caudal fin	Fig. 5 from Rosowski et al., 2016
neutrophil migration decreased occurrence, abnormal	rac2^uwm32/uwm32; zf306Tg	transection: caudal fin	Fig. 2 from Rosowski et al., 2016
defense response to bacterium process efficacy, ameliorated	rac2^uwm32/uwm32; zf306Tg	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 5 from Rosowski et al., 2016
neutrophil migration occurrence, ameliorated	rac2^uwm32/uwm32; zf306Tg	transection: caudal fin	Fig. 5 from Rosowski et al., 2016
whole organism decreased life span, ameliorated	rac2^uwm32/uwm32; zf306Tg	bacterial treatment by injection: Pseudomonas aeruginosa PAK	Fig. 5 from Rosowski et al., 2016
circulating cell neutrophil increased amount, abnormal	rac2^uwm32/uwm32; zf307Tg	control	Fig. 3 from Rosowski et al., 2016
macrophage defense response to fungus decreased process quality, abnormal	rac2^uwm32/uwm32; zf307Tg/zf307Tg	fungal treatment by injection: Aspergillus fumigatus	Fig 4 from Tanner et al., 2024
whole organism viability, abnormal	rac2^uwm32/uwm32; zf307Tg/zf307Tg	fungal treatment by injection: Aspergillus fumigatus	Fig 4 from Tanner et al., 2024

Citations

Include unpublished citations

Rosowski, E.E., Deng, Q., Keller, N.P., Huttenlocher, A. (2016) Rac2 Functions in Both Neutrophils and Macrophages To Mediate Motility and Host Defense in Larval Zebrafish. Journal of immunology (Baltimore, Md. : 1950). 197(12):4780-4790

1 - 1 of 1

Show