TALEN

TALEN2-rac2

ID
ZDB-TALEN-170410-2
Name
TALEN2-rac2
Previous Names
None
Target
Target Sequence 1
5' - TCCAATTATCCTGGTTGGCAC - 3'
Target Sequence 2
5' - TCGATGGTCTCCTTCTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uwm31 rac2
uwm32 rac2
Expression
Gene expression in Wild Types + TALEN2-rac2
No data available
Phenotype
Phenotype resulting from TALEN2-rac2
No data available
Phenotype of all Fish created by or utilizing TALEN2-rac2
Phenotype Fish Conditions Figures
neutrophil migration decreased occurrence, abnormal rac2uwm31/uwm31 transection: caudal fin Fig. 2 from Rosowski et al., 2016
whole organism decreased life span, abnormal rac2uwm32/uwm32 standard conditions Fig. 1 from Rosowski et al., 2016
neutrophil migration decreased occurrence, abnormal rac2uwm32/uwm32 transection: caudal fin Fig. 5 from Rosowski et al., 2016
whole organism decreased life span, exacerbated rac2uwm32/uwm32 fungal treatment by injection: Aspergillus fumigatus Fig. 4 from Rosowski et al., 2016
whole organism decreased life span, abnormal rac2uwm32/uwm32 bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 6 from Rosowski et al., 2016
neutrophil migration decreased occurrence, abnormal rac2uwm32/uwm32 transection: caudal fin Fig. 2 from Rosowski et al., 2016
whole organism decreased life span, abnormal rac2uwm32/uwm32 bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 5 from Rosowski et al., 2016
neutrophil decreased amount, abnormal rac2uwm32/uwm32 control Fig. 5 from Rosowski et al., 2016
macrophage defense response to fungus decreased process quality, abnormal rac2uwm32/uwm32 fungal treatment by injection: Aspergillus fumigatus Fig 5 with image from Tanner et al., 2024
defense response to fungus decreased efficacy, exacerbated rac2uwm32/uwm32 fungal treatment by injection: Aspergillus fumigatus Fig. 4 from Rosowski et al., 2016
whole organism decreased size, abnormal rac2uwm32/uwm32 standard conditions Fig. 1 from Rosowski et al., 2016
defense response to bacterium decreased efficacy, abnormal rac2uwm32/uwm32 bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 5 from Rosowski et al., 2016
whole organism decreased length, abnormal rac2uwm32/uwm32 standard conditions Fig. 1 from Rosowski et al., 2016
macrophage detection of fungus decreased process quality, abnormal rac2uwm32/uwm32 fungal treatment by injection: Aspergillus fumigatus Fig 3 with image from Tanner et al., 2024
otic vesicle neutrophil decreased amount, abnormal rac2uwm32/uwm32 control Fig. 5 from Rosowski et al., 2016
defense response to bacterium decreased efficacy, abnormal rac2uwm32/uwm32 bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 6 from Rosowski et al., 2016
neutrophil migration decreased occurrence, exacerbated rac2uwm32/uwm32 bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 5 from Rosowski et al., 2016
whole organism viability, abnormal rac2uwm32/uwm32 fungal treatment by injection: Aspergillus fumigatus Fig 1 with image from Tanner et al., 2024
response to fungus process quality, abnormal rac2uwm32/uwm32 fungal treatment by injection: Aspergillus fumigatus Fig 1 with image from Tanner et al., 2024
whole organism decreased life span, exacerbated rac2uwm32/uwm32 bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 4 from Rosowski et al., 2016
defense response to bacterium decreased efficacy, exacerbated rac2uwm32/uwm32 bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 4 from Rosowski et al., 2016
fin broken, abnormal rac2uwm32/uwm32 standard conditions Fig. 1 from Rosowski et al., 2016
whole organism decreased life span, abnormal rac2uwm32/+ fungal treatment by injection: Aspergillus fumigatus Fig. 4 from Rosowski et al., 2016
defense response to fungus decreased efficacy, abnormal rac2uwm32/+ fungal treatment by injection: Aspergillus fumigatus Fig. 4 from Rosowski et al., 2016
neutrophil migration decreased occurrence, abnormal rac2uwm32/+ bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 5 from Rosowski et al., 2016
whole organism decreased life span, abnormal rac2uwm32/+ bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 4 from Rosowski et al., 2016
defense response to bacterium decreased efficacy, abnormal rac2uwm32/+ bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 4 from Rosowski et al., 2016
neutrophil migration decreased occurrence, abnormal rac2uwm32/uwm32; uwm7Tg transection: caudal fin Fig. 2 from Rosowski et al., 2016
trunk neutrophil decreased amount, abnormal rac2uwm32/uwm32; uwm7Tg control Fig. 3 from Rosowski et al., 2016
pericardium neutrophil increased amount, abnormal rac2uwm32/uwm32; uwm7Tg control Fig. 3 from Rosowski et al., 2016
neutrophil decreased amount, abnormal rac2uwm32/uwm32; uwm7Tg control Fig. 3 from Rosowski et al., 2016
neutrophil decreased velocity, abnormal rac2uwm32/uwm32; uwm7Tg transection: caudal fin Fig. 2 from Rosowski et al., 2016
macrophage migration decreased occurrence, abnormal rac2uwm32/uwm32; uwm7Tg transection: caudal fin Fig. 7 from Rosowski et al., 2016
head neutrophil decreased amount, abnormal rac2uwm32/uwm32; uwm7Tg control Fig. 3 from Rosowski et al., 2016
whole organism decreased life span, ameliorated rac2uwm32/uwm32; uwm7Tg bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 6 from Rosowski et al., 2016
otic vesicle macrophage decreased amount, abnormal rac2uwm32/uwm32; uwm12Tg transection: caudal fin Fig. 7 from Rosowski et al., 2016
macrophage migration decreased occurrence, abnormal rac2uwm32/uwm32; uwm12Tg transection: caudal fin Fig. 7 from Rosowski et al., 2016
macrophage decreased velocity, abnormal rac2uwm32/uwm32; uwm12Tg transection: caudal fin Fig. 7 from Rosowski et al., 2016
macrophage migration decreased occurrence, abnormal rac2uwm32/uwm32; uwm12Tg transection: caudal fin Fig. 7 from Rosowski et al., 2016
macrophage detection of fungus decreased process quality, abnormal rac2uwm32/uwm32; xt12Tg/xt12Tg fungal treatment by injection: Aspergillus fumigatus Fig 2 with image from Tanner et al., 2024
circulating cell neutrophil increased amount, abnormal rac2uwm32/uwm32; uwm7Tg; zf307Tg control Fig. 3 from Rosowski et al., 2016
macrophage migration decreased occurrence, abnormal rac2uwm32/uwm32; uwm12Tg; zf306Tg transection: caudal fin Fig. 7 from Rosowski et al., 2016
macrophage migration occurrence, ameliorated rac2uwm32/uwm32; uwm27Tg transection: caudal fin Fig. 7 from Rosowski et al., 2016
macrophage defense response to fungus decreased process quality, ameliorated rac2uwm32/uwm32; uwm27Tg/uwm27Tg fungal treatment by injection: Aspergillus fumigatus Fig 5 with image from Tanner et al., 2024
whole organism decreased life span, ameliorated rac2uwm32/uwm32; uwm28Tg bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 5 from Rosowski et al., 2016
defense response to bacterium process efficacy, ameliorated rac2uwm32/uwm32; uwm28Tg bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 5 from Rosowski et al., 2016
neutrophil migration occurrence, ameliorated rac2uwm32/uwm32; uwm28Tg transection: caudal fin Fig. 5 from Rosowski et al., 2016
neutrophil migration decreased occurrence, abnormal rac2uwm32/uwm32; zf306Tg transection: caudal fin Fig. 2 from Rosowski et al., 2016
defense response to bacterium process efficacy, ameliorated rac2uwm32/uwm32; zf306Tg bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 5 from Rosowski et al., 2016
neutrophil migration occurrence, ameliorated rac2uwm32/uwm32; zf306Tg transection: caudal fin Fig. 5 from Rosowski et al., 2016
whole organism decreased life span, ameliorated rac2uwm32/uwm32; zf306Tg bacterial treatment by injection: Pseudomonas aeruginosa PAK Fig. 5 from Rosowski et al., 2016
circulating cell neutrophil increased amount, abnormal rac2uwm32/uwm32; zf307Tg control Fig. 3 from Rosowski et al., 2016
macrophage defense response to fungus decreased process quality, abnormal rac2uwm32/uwm32; zf307Tg/zf307Tg fungal treatment by injection: Aspergillus fumigatus Fig 4 with image from Tanner et al., 2024
whole organism viability, abnormal rac2uwm32/uwm32; zf307Tg/zf307Tg fungal treatment by injection: Aspergillus fumigatus Fig 4 with image from Tanner et al., 2024
Citations