TALEN

TALEN1-aplnra

ID
ZDB-TALEN-151016-1
Name
TALEN1-aplnra
Previous Names
None
Target
Target Sequence 1
5' - GAATACACCGAGACATACGAT - 3'
Target Sequence 2
5' - TCACACCCAGAGTCATTATA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mu296 aplnra
Expression
Gene expression in Wild Types + TALEN1-aplnra
No data available
Phenotype
Phenotype resulting from TALEN1-aplnra
No data available
Phenotype of all Fish created by or utilizing TALEN1-aplnra
Citations