Morpholino

MO1-ddr2a

ID
ZDB-MRPHLNO-260813-1
Name
MO1-ddr2a
Previous Names
None
Target
Sequence
5' - ATTCTGCTTGCGCTGTTTTTTTCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ddr2a
No data available
Phenotype
Phenotype resulting from MO1-ddr2a
Phenotype of all Fish created by or utilizing MO1-ddr2a
Phenotype Fish Conditions Figures
palatoquadrate cartilage Ab6-col2a1 labeling increased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
palatoquadrate cartilage malformed, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
interhyal cartilage Ab1-ddr2 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
hyohyoideus Ab1-ddr2 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
palatoquadrate cartilage Ab6-col2a1 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
hyohyoideus Ab1-ddr2 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage Ab6-col2a1 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
sternohyoid Ab1-ddr2 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
interhyal cartilage Ab1-ddr2 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage shortened, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage Ab6-col2a1 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
sternohyoid Ab1-ddr2 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
cranial skeletal system development decreased process quality, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 3 with image from Capecki et al., 2026
palatoquadrate cartilage malformed, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
palatoquadrate cartilage Ab6-col2a1 labeling increased amount, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
interhyal cartilage Ab1-ddr2 labeling decreased amount, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
palatoquadrate cartilage Ab6-col2a1 labeling spatial pattern, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
hyohyoideus Ab1-ddr2 labeling spatial pattern, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
hyohyoideus Ab1-ddr2 labeling decreased amount, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage Ab6-col2a1 labeling spatial pattern, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
sternohyoid Ab1-ddr2 labeling spatial pattern, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage shortened, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
interhyal cartilage Ab1-ddr2 labeling spatial pattern, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage Ab6-col2a1 labeling decreased amount, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
cranial skeletal system development decreased process quality, abnormal WT + MO1-ddr2a standard conditions Figure 3 with image from Capecki et al., 2026
sternohyoid Ab1-ddr2 labeling decreased amount, abnormal WT + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
Citations