Morpholino

MO2-atp2a2a

ID
ZDB-MRPHLNO-251030-1
Name
MO2-atp2a2a
Previous Names
None
Target
Sequence
5' - ACAATCTGTTTACTGACCTGCCAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-atp2a2a
No data available
Phenotype
Phenotype resulting from MO2-atp2a2a
Phenotype Fish Figures
eye decreased area, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 Fig. S6 from Malaichamy et al., 2025
locomotion decreased frequency, abnormal s1020tEt; s1985tTg + MO2-atp2a2a Fig. 4,  Fig. S6 from Malaichamy et al., 2025
slow muscle cell decreased area, abnormal s1020tEt; s1985tTg + MO2-atp2a2a Fig. S7 from Malaichamy et al., 2025
slow muscle cell decreased diameter, abnormal s1020tEt; s1985tTg + MO2-atp2a2a Fig. S7 from Malaichamy et al., 2025
slow muscle cell decreased length, abnormal s1020tEt; s1985tTg + MO2-atp2a2a Fig. S7 from Malaichamy et al., 2025
slow muscle cell decreased perimeter, abnormal s1020tEt; s1985tTg + MO2-atp2a2a Fig. S7 from Malaichamy et al., 2025
swimming behavior decreased process quality, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 Fig. 4,  Fig. S6 from Malaichamy et al., 2025
trunk muscle decreased area, abnormal s1020tEt; s1985tTg + MO2-atp2a2a Fig. S6 from Malaichamy et al., 2025
whole organism atp2a2a expression absent, abnormal s1020tEt; s1985tTg + MO2-atp2a2a Fig. S5 from Malaichamy et al., 2025
whole organism decreased length, abnormal s1020tEt; s1985tTg + MO2-atp2a2a Fig. S6 from Malaichamy et al., 2025
Phenotype of all Fish created by or utilizing MO2-atp2a2a
Phenotype Fish Conditions Figures
slow muscle cell decreased diameter, abnormal s1020tEt; s1985tTg + MO2-atp2a2a control Fig. S7 from Malaichamy et al., 2025
swimming behavior decreased process quality, abnormal s1020tEt; s1985tTg + MO2-atp2a2a altered light dark cycle Fig. 4 from Malaichamy et al., 2025
slow muscle cell decreased area, abnormal s1020tEt; s1985tTg + MO2-atp2a2a control Fig. S7 from Malaichamy et al., 2025
whole organism decreased length, abnormal s1020tEt; s1985tTg + MO2-atp2a2a control Fig. S6 from Malaichamy et al., 2025
slow muscle cell decreased length, abnormal s1020tEt; s1985tTg + MO2-atp2a2a control Fig. S7 from Malaichamy et al., 2025
swimming behavior decreased process quality, abnormal s1020tEt; s1985tTg + MO2-atp2a2a altered light dark cycle Fig. 4 from Malaichamy et al., 2025
swimming behavior decreased process quality, abnormal s1020tEt; s1985tTg + MO2-atp2a2a control Fig. 4,  Fig. S6 from Malaichamy et al., 2025
slow muscle cell decreased perimeter, abnormal s1020tEt; s1985tTg + MO2-atp2a2a control Fig. S7 from Malaichamy et al., 2025
whole organism atp2a2a expression absent, abnormal s1020tEt; s1985tTg + MO2-atp2a2a control Fig. S5 from Malaichamy et al., 2025
locomotion decreased frequency, abnormal s1020tEt; s1985tTg + MO2-atp2a2a control Fig. 4,  Fig. S6 from Malaichamy et al., 2025
trunk muscle decreased area, abnormal s1020tEt; s1985tTg + MO2-atp2a2a control Fig. S6 from Malaichamy et al., 2025
whole organism decreased length, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 control Fig. S6 from Malaichamy et al., 2025
eye decreased area, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 control Fig. S6 from Malaichamy et al., 2025
locomotion decreased frequency, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 control Fig. S6 from Malaichamy et al., 2025
swimming behavior decreased process quality, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 control Fig. S6 from Malaichamy et al., 2025
trunk muscle decreased area, abnormal s1020tEt; s1985tTg + MO2-atp2a2a + MO4-tp53 control Fig. S6 from Malaichamy et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.