Morpholino

MO2-erbb3b

ID

ZDB-MRPHLNO-241029-1

Name

MO2-erbb3b

Previous Names

None

Target

Sequence

5' - ATATTCTGATCTCAATCTCACCTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-erbb3b

No data available

Phenotype

Phenotype resulting from MO2-erbb3b

Phenotype	Fish	Figures
caudal fin curved, abnormal	AB + MO2-erbb3b	Fig. 4 from Liu et al., 2023
ceratohyal cartilage malformed, abnormal	AB + MO2-erbb3b	Fig. 5 from Liu et al., 2023
cranial skeletal system development disrupted, abnormal	AB + MO2-erbb3b	Fig. 5 from Liu et al., 2023
dorsal root ganglion decreased amount, abnormal	AB + MO2-erbb3b	Fig. 4 from Liu et al., 2023
enteric neuron decreased amount, abnormal	AB + MO2-erbb3b	Fig. 4 from Liu et al., 2023
Meckel's cartilage shortened, abnormal	AB + MO2-erbb3b	Fig. 5 from Liu et al., 2023
pericardium edematous, abnormal	AB + MO2-erbb3b	Fig. 4 from Liu et al., 2023
posterior intestine enteric neuron decreased amount, abnormal	AB + MO2-erbb3b	Fig. 4 from Liu et al., 2023
whole organism decreased life span, abnormal	AB + MO2-erbb3b	Fig. 4 from Liu et al., 2023
whole organism malformed, abnormal	AB + MO2-erbb3b	Fig. 4 from Liu et al., 2023

Phenotype of all Fish created by or utilizing MO2-erbb3b

Phenotype	Fish	Conditions	Figures
ceratohyal cartilage malformed, abnormal	AB + MO2-erbb3b	standard conditions	Fig. 5 from Liu et al., 2023
whole organism malformed, abnormal	AB + MO2-erbb3b	standard conditions	Fig. 4 from Liu et al., 2023
dorsal root ganglion decreased amount, abnormal	AB + MO2-erbb3b	standard conditions	Fig. 4 from Liu et al., 2023
pericardium edematous, abnormal	AB + MO2-erbb3b	standard conditions	Fig. 4 from Liu et al., 2023
enteric neuron decreased amount, abnormal	AB + MO2-erbb3b	standard conditions	Fig. 4 from Liu et al., 2023
cranial skeletal system development disrupted, abnormal	AB + MO2-erbb3b	standard conditions	Fig. 5 from Liu et al., 2023
Meckel's cartilage shortened, abnormal	AB + MO2-erbb3b	standard conditions	Fig. 5 from Liu et al., 2023
posterior intestine enteric neuron decreased amount, abnormal	AB + MO2-erbb3b	standard conditions	Fig. 4 from Liu et al., 2023
caudal fin curved, abnormal	AB + MO2-erbb3b	standard conditions	Fig. 4 from Liu et al., 2023
whole organism decreased life span, abnormal	AB + MO2-erbb3b	standard conditions	Fig. 4 from Liu et al., 2023

Citations