Morpholino

MO2-socs4

ID

ZDB-MRPHLNO-231115-2

Name

MO2-socs4

Previous Names

Target

Sequence

5' - ATGTTCTCACAGAAGAGTGGTGAAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-socs4

Expressed Gene	Anatomy	Figures
ins	pancreatic B cell	Figure 3 from Trengove et al., 2022

Phenotype

Phenotype resulting from MO2-socs4

Phenotype	Fish	Figures
convergent extension disrupted, abnormal	WT + MO2-socs4	Figure 3 from Trengove et al., 2022
convergent extension involved in notochord morphogenesis disrupted, abnormal	WT + MO2-socs4	Figure 3 from Trengove et al., 2022
musculoskeletal movement, spinal reflex action decreased process quality, abnormal	WT + MO2-socs4	Figure 4 from Trengove et al., 2022
notochord undulate, abnormal	WT + MO2-socs4	Figure 3 from Trengove et al., 2022
notochord posterior region split, abnormal	WT + MO2-socs4	Figure 3 from Trengove et al., 2022
pancreatic B cell ins expression spatial pattern, abnormal	WT + MO2-socs4	Figure 3 from Trengove et al., 2022
post-vent region curved ventral, abnormal	WT + MO2-socs4 + MO4-tp53	Figure 2 from Trengove et al., 2022
sensory perception of touch disrupted, abnormal	WT + MO2-socs4	Figure 4 from Trengove et al., 2022
whole organism increased curvature, abnormal	WT + MO2-socs4	Figure 2 from Trengove et al., 2022

Phenotype of all Fish created by or utilizing MO2-socs4

Phenotype	Fish	Conditions	Figures
notochord undulate, abnormal	WT + MO2-socs4	standard conditions	Figure 3 from Trengove et al., 2022
musculoskeletal movement, spinal reflex action decreased process quality, abnormal	WT + MO2-socs4	standard conditions	Figure 4 from Trengove et al., 2022
whole organism increased curvature, abnormal	WT + MO2-socs4	standard conditions	Figure 2 from Trengove et al., 2022
sensory perception of touch disrupted, abnormal	WT + MO2-socs4	standard conditions	Figure 4 from Trengove et al., 2022
post-vent region curved ventral, abnormal	WT + MO2-socs4	standard conditions	Figure 2 from Trengove et al., 2022
convergent extension disrupted, abnormal	WT + MO2-socs4	standard conditions	Figure 3 from Trengove et al., 2022
pancreatic B cell ins expression spatial pattern, abnormal	WT + MO2-socs4	standard conditions	Figure 3 from Trengove et al., 2022
notochord posterior region split, abnormal	WT + MO2-socs4	standard conditions	Figure 3 from Trengove et al., 2022
convergent extension involved in notochord morphogenesis disrupted, abnormal	WT + MO2-socs4	standard conditions	Figure 3 from Trengove et al., 2022
whole organism increased curvature, abnormal	WT + MO2-socs4 + MO4-tp53	standard conditions	Figure 2 from Trengove et al., 2022
post-vent region curved ventral, abnormal	WT + MO2-socs4 + MO4-tp53	standard conditions	Figure 2 from Trengove et al., 2022

Citations