Morpholino

MO1-fars2

ID
ZDB-MRPHLNO-230123-1
Name
MO1-fars2
Previous Names
None
Target
Sequence
5' - CATAGTAGCTGGTCCATAAGCCTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fars2
No data available
Phenotype
Phenotype resulting from MO1-fars2
Phenotype Fish Figures
angiogenic sprout decreased amount, abnormal y1Tg + MO1-fars2 Figure 2 with image from Li et al., 2021
caudal vein plexus morphology, abnormal y1Tg + MO1-fars2 Figure 2 with image from Li et al., 2021
developmental growth delayed, abnormal AB + MO1-fars2 Figure 1 with image from Li et al., 2021
heart decreased functionality, abnormal AB + MO1-fars2 text only from Li et al., 2024
intersegmental vessel decreased amount, abnormal y1Tg + MO1-fars2 Figure 2 with image from Li et al., 2021
intersegmental vessel decreased length, abnormal y1Tg + MO1-fars2 Figure 2 with image from Li et al., 2021
motor neuron axon decreased length, abnormal AB + MO1-fars2 Fig. 7 with image from Chen et al., 2022
myotome C-shaped, abnormal AB + MO1-fars2 Fig. 7 with image from Chen et al., 2022
parachordal vessel morphology, abnormal y1Tg + MO1-fars2 Figure 2 with image from Li et al., 2021
pericardium edematous, abnormal AB + MO1-fars2 Figure 2. with image from Li et al., 2024
post-vent region curved, abnormal AB + MO1-fars2 Fig. 7 with image from Chen et al., 2022
trunk curved, abnormal AB + MO1-fars2 Figure 1 with image from Li et al., 2021
whole organism dead, abnormal AB + MO1-fars2 Fig. 7 with image from Chen et al., 2022
whole organism lef1 expression decreased amount, abnormal AB + MO1-fars2 Figure 5 with image from Li et al., 2021
whole organism ctnnb1 expression decreased amount, abnormal AB + MO1-fars2 Figure 5 with image from Li et al., 2021
whole organism wnt9a expression decreased amount, abnormal AB + MO1-fars2 Figure 5 with image from Li et al., 2021
whole organism gsk3ba expression decreased amount, abnormal AB + MO1-fars2 Figure 5 with image from Li et al., 2021
whole organism axin1 expression decreased amount, abnormal AB + MO1-fars2 Figure 5 with image from Li et al., 2021
whole organism decreased life span, abnormal AB + MO1-fars2 Figure 1 with image from Li et al., 2021
whole organism hey2 expression increased amount, abnormal AB + MO1-fars2 Figure 5 with image from Li et al., 2021
whole organism notch1b expression increased amount, abnormal AB + MO1-fars2 Figure 5 with image from Li et al., 2021
whole organism dkk1b expression increased amount, abnormal AB + MO1-fars2 Figure 5 with image from Li et al., 2021
whole organism viability, abnormal AB + MO1-fars2 Fig. 7 with image from Chen et al., 2022
yolk syncytial layer increased size, abnormal AB + MO1-fars2 Figure 1 with image from Li et al., 2021
Phenotype of all Fish created by or utilizing MO1-fars2
Phenotype Fish Conditions Figures
whole organism lef1 expression decreased amount, abnormal AB + MO1-fars2 standard conditions Figure 5 with image from Li et al., 2021
whole organism gsk3ba expression decreased amount, abnormal AB + MO1-fars2 standard conditions Figure 5 with image from Li et al., 2021
post-vent region curved, abnormal AB + MO1-fars2 control Fig. 7 with image from Chen et al., 2022
whole organism decreased life span, abnormal AB + MO1-fars2 standard conditions Figure 1 with image from Li et al., 2021
heart decreased functionality, abnormal AB + MO1-fars2 standard conditions text only from Li et al., 2024
whole organism dkk1b expression increased amount, abnormal AB + MO1-fars2 standard conditions Figure 5 with image from Li et al., 2021
myotome C-shaped, abnormal AB + MO1-fars2 control Fig. 7 with image from Chen et al., 2022
whole organism axin1 expression decreased amount, abnormal AB + MO1-fars2 standard conditions Figure 5 with image from Li et al., 2021
motor neuron axon decreased length, abnormal AB + MO1-fars2 control Fig. 7 with image from Chen et al., 2022
yolk syncytial layer increased size, abnormal AB + MO1-fars2 standard conditions Figure 1 with image from Li et al., 2021
whole organism notch1b expression increased amount, abnormal AB + MO1-fars2 standard conditions Figure 5 with image from Li et al., 2021
developmental growth delayed, abnormal AB + MO1-fars2 standard conditions Figure 1 with image from Li et al., 2021
pericardium edematous, abnormal AB + MO1-fars2 standard conditions Figure 2. with image from Li et al., 2024
whole organism wnt9a expression decreased amount, abnormal AB + MO1-fars2 standard conditions Figure 5 with image from Li et al., 2021
whole organism viability, abnormal AB + MO1-fars2 control Fig. 7 with image from Chen et al., 2022
whole organism dead, abnormal AB + MO1-fars2 control Fig. 7 with image from Chen et al., 2022
trunk curved, abnormal AB + MO1-fars2 standard conditions Figure 1 with image from Li et al., 2021
whole organism ctnnb1 expression decreased amount, abnormal AB + MO1-fars2 standard conditions Figure 5 with image from Li et al., 2021
whole organism hey2 expression increased amount, abnormal AB + MO1-fars2 standard conditions Figure 5 with image from Li et al., 2021
caudal vein plexus morphology, abnormal y1Tg + MO1-fars2 standard conditions Figure 2 with image from Li et al., 2021
parachordal vessel morphology, abnormal y1Tg + MO1-fars2 standard conditions Figure 2 with image from Li et al., 2021
intersegmental vessel decreased length, abnormal y1Tg + MO1-fars2 standard conditions Figure 2 with image from Li et al., 2021
angiogenic sprout decreased amount, abnormal y1Tg + MO1-fars2 standard conditions Figure 2 with image from Li et al., 2021
intersegmental vessel decreased amount, abnormal y1Tg + MO1-fars2 standard conditions Figure 2 with image from Li et al., 2021
Citations