Morpholino

MO4-cldn3c

ID

ZDB-MRPHLNO-220318-1

Name

MO4-cldn3c

Previous Names

None

Target

cldn3c (1)

Sequence

5' - ATGAATGTCATTTACCAAGTGTCGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-cldn3c

Expressed Gene	Anatomy	Figures
eya1	neuromast	FIGURE 6 from Gong et al., 2021

Phenotype

Phenotype resulting from MO4-cldn3c

Phenotype	Fish	Figures
anterior crista cilium decreased length, abnormal	s356tTg + MO4-cldn3c (AB)	FIGURE 4 , FIGURE 6 from Gong et al., 2021
anterior crista hair cell decreased amount, abnormal	s356tTg + MO4-cldn3c (AB)	FIGURE 4 , FIGURE 6 from Gong et al., 2021
lapillus absence of anatomical entity, abnormal	AB + MO4-cldn3c	FIGURE 2 from Gong et al., 2021
lateral crista cilium decreased length, abnormal	s356tTg + MO4-cldn3c (AB)	FIGURE 4 , FIGURE 6 from Gong et al., 2021
lateral crista hair cell decreased amount, abnormal	s356tTg + MO4-cldn3c (AB)	FIGURE 4 , FIGURE 6 from Gong et al., 2021
neuromast eya1 expression decreased distribution, abnormal	AB + MO4-cldn3c	FIGURE 6 from Gong et al., 2021
neuromast hair cell apoptotic process increased process quality, abnormal	s356tTg + MO4-cldn3c (AB)	FIGURE 7 from Gong et al., 2021
otic vesicle decreased area, abnormal	AB + MO4-cldn3c	FIGURE 2 , FIGURE 6 from Gong et al., 2021
otolith decreased amount, abnormal	AB + MO4-cldn3c	FIGURE 2 from Gong et al., 2021
otolith shape, abnormal	AB + MO4-cldn3c	FIGURE 2 from Gong et al., 2021
posterior crista cilium decreased length, abnormal	s356tTg + MO4-cldn3c (AB)	FIGURE 4 , FIGURE 6 from Gong et al., 2021
posterior crista hair cell decreased amount, abnormal	s356tTg + MO4-cldn3c (AB)	FIGURE 4 , FIGURE 6 from Gong et al., 2021
posterior lateral line neuromast decreased amount, abnormal	s356tTg + MO4-cldn3c (AB)	FIGURE 6 from Gong et al., 2021
posterior lateral line neuromast hair cell decreased amount, abnormal	s356tTg + MO4-cldn3c (AB)	FIGURE 5 , FIGURE 6 from Gong et al., 2021
sagitta shape, abnormal	AB + MO4-cldn3c	FIGURE 2 from Gong et al., 2021
whole organism detection of mechanical stimulus involved in sensory perception of sound decreased process quality, abnormal	AB + MO4-cldn3c	FIGURE 3 from Gong et al., 2021
whole organism swimming behavior decreased process quality, abnormal	AB + MO4-cldn3c	FIGURE 3 from Gong et al., 2021

Phenotype of all Fish created by or utilizing MO4-cldn3c

Phenotype	Fish	Conditions	Figures
otic vesicle decreased area, abnormal	AB + MO4-cldn3c	control	FIGURE 2 from Gong et al., 2021
lapillus absence of anatomical entity, abnormal	AB + MO4-cldn3c	control	FIGURE 2 from Gong et al., 2021
neuromast eya1 expression decreased distribution, abnormal	AB + MO4-cldn3c	control	FIGURE 6 from Gong et al., 2021
otolith shape, abnormal	AB + MO4-cldn3c	control	FIGURE 2 from Gong et al., 2021
sagitta shape, abnormal	AB + MO4-cldn3c	control	FIGURE 2 from Gong et al., 2021
otolith decreased amount, abnormal	AB + MO4-cldn3c	control	FIGURE 2 from Gong et al., 2021
whole organism swimming behavior decreased process quality, abnormal	AB + MO4-cldn3c	control	FIGURE 3 from Gong et al., 2021
whole organism detection of mechanical stimulus involved in sensory perception of sound decreased process quality, abnormal	AB + MO4-cldn3c	control	FIGURE 3 from Gong et al., 2021
posterior lateral line neuromast decreased amount, abnormal	s356tTg + MO4-cldn3c (AB)	control	FIGURE 6 from Gong et al., 2021
posterior crista cilium decreased length, abnormal	s356tTg + MO4-cldn3c (AB)	control	FIGURE 4 , FIGURE 6 from Gong et al., 2021
otic vesicle decreased area, abnormal	s356tTg + MO4-cldn3c (AB)	control	FIGURE 6 from Gong et al., 2021
posterior crista hair cell decreased amount, abnormal	s356tTg + MO4-cldn3c (AB)	control	FIGURE 4 , FIGURE 6 from Gong et al., 2021
lateral crista cilium decreased length, abnormal	s356tTg + MO4-cldn3c (AB)	control	FIGURE 4 , FIGURE 6 from Gong et al., 2021
posterior lateral line neuromast hair cell decreased amount, abnormal	s356tTg + MO4-cldn3c (AB)	control	FIGURE 5 , FIGURE 6 from Gong et al., 2021
anterior crista cilium decreased length, abnormal	s356tTg + MO4-cldn3c (AB)	control	FIGURE 4 , FIGURE 6 from Gong et al., 2021
neuromast hair cell apoptotic process increased process quality, abnormal	s356tTg + MO4-cldn3c (AB)	control	FIGURE 7 from Gong et al., 2021
lateral crista hair cell decreased amount, abnormal	s356tTg + MO4-cldn3c (AB)	control	FIGURE 4 , FIGURE 6 from Gong et al., 2021
anterior crista hair cell decreased amount, abnormal	s356tTg + MO4-cldn3c (AB)	control	FIGURE 4 , FIGURE 6 from Gong et al., 2021

Citations