Morpholino

MO1-hhatla

ID
ZDB-MRPHLNO-220301-1
Name
MO1-hhatla
Previous Names
None
Target
Sequence
5' - GGCCTCCAGTGGTACACTTTATTTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hhatla
Expressed Gene Anatomy Figures
atp2a2a Fig. 5 from Shi et al., 2020
myh7 Fig. 3 from Shi et al., 2020
myl7 Fig. 3 from Shi et al., 2020
nppa Fig. 5 from Shi et al., 2020
nppb Fig. 4,  Fig. 5 from Shi et al., 2020
ppp3r1a Fig. 5 from Shi et al., 2020
Phenotype
Phenotype resulting from MO1-hhatla
Phenotype Fish Figures
atrium myl7 expression increased amount, abnormal WT + MO1-hhatla Fig. 3 from Shi et al., 2020
atrium myl7 expression increased distribution, abnormal WT + MO1-hhatla Fig. 3 from Shi et al., 2020
bulbus arteriosus distended, abnormal WT + MO1-hhatla Fig. 3 from Shi et al., 2020
cardiac ventricle decreased functionality, abnormal twu34Tg + MO1-hhatla Fig. 2 from Shi et al., 2020
cardiac ventricle deformed, abnormal twu34Tg + MO1-hhatla Fig. 2 from Shi et al., 2020
cardiac ventricle myh7 expression increased amount, abnormal WT + MO1-hhatla Fig. 3 from Shi et al., 2020
cardiac ventricle myl7 expression increased amount, abnormal WT + MO1-hhatla Fig. 3 from Shi et al., 2020
cardiac ventricle myh7 expression increased distribution, abnormal WT + MO1-hhatla Fig. 3 from Shi et al., 2020
cardiac ventricle myl7 expression increased distribution, abnormal WT + MO1-hhatla Fig. 3 from Shi et al., 2020
cardiac ventricle increased size, abnormal WT + MO1-hhatla Fig. 3 from Shi et al., 2020
heart Ab4-atp2a2 labeling decreased amount, abnormal twu34Tg + MO1-hhatla Fig. 5 from Shi et al., 2020
heart atp2a2a expression decreased amount, abnormal twu34Tg + MO1-hhatla Fig. 5 from Shi et al., 2020
heart ppp3r1a expression increased amount, abnormal twu34Tg + MO1-hhatla Fig. 5 from Shi et al., 2020
heart myh7 expression increased amount, abnormal twu34Tg + MO1-hhatla Fig. 3 from Shi et al., 2020
heart nppb expression increased amount, abnormal WT + MO1-hhatla Fig. 4,  Fig. 5 from Shi et al., 2020
heart nppa expression increased amount, abnormal twu34Tg + MO1-hhatla Fig. 5 from Shi et al., 2020
heart myl7 expression increased amount, abnormal twu34Tg + MO1-hhatla Fig. 3 from Shi et al., 2020
heart nppb expression increased distribution, abnormal WT + MO1-hhatla Fig. 4 from Shi et al., 2020
heart morphology, abnormal twu34Tg + MO1-hhatla Fig. 5 from Shi et al., 2020
heart contraction decreased rate, abnormal twu34Tg + MO1-hhatla Fig. 2 from Shi et al., 2020
myotome disorganized, abnormal WT + MO1-hhatla Fig. 3 from Shi et al., 2020
post-vent region curved ventral, abnormal twu34Tg + MO1-hhatla Fig. 2,  Fig. 5 from Shi et al., 2020
post-vent region rough, abnormal twu34Tg + MO1-hhatla Fig. 2,  Fig. 5 from Shi et al., 2020
post-vent region shortened, abnormal twu34Tg + MO1-hhatla Fig. 2,  Fig. 5 from Shi et al., 2020
Phenotype of all Fish created by or utilizing MO1-hhatla
Phenotype Fish Conditions Figures
cardiac ventricle myl7 expression increased distribution, abnormal WT + MO1-hhatla control Fig. 3 from Shi et al., 2020
myotome disorganized, abnormal WT + MO1-hhatla control Fig. 3 from Shi et al., 2020
heart nppb expression increased amount, abnormal WT + MO1-hhatla control Fig. 4 from Shi et al., 2020
cardiac ventricle myh7 expression increased distribution, abnormal WT + MO1-hhatla control Fig. 3 from Shi et al., 2020
heart nppb expression increased distribution, abnormal WT + MO1-hhatla control Fig. 4 from Shi et al., 2020
cardiac ventricle myh7 expression increased amount, abnormal WT + MO1-hhatla control Fig. 3 from Shi et al., 2020
atrium myl7 expression increased distribution, abnormal WT + MO1-hhatla control Fig. 3 from Shi et al., 2020
cardiac ventricle increased size, abnormal WT + MO1-hhatla control Fig. 3 from Shi et al., 2020
cardiac ventricle myl7 expression increased amount, abnormal WT + MO1-hhatla control Fig. 3 from Shi et al., 2020
bulbus arteriosus distended, abnormal WT + MO1-hhatla control Fig. 3 from Shi et al., 2020
atrium myl7 expression increased amount, abnormal WT + MO1-hhatla control Fig. 3 from Shi et al., 2020
heart morphology, ameliorated twu34Tg + MO1-hhatla chemical treatment: tacrolimus (anhydrous) Fig. 5 from Shi et al., 2020
post-vent region curved ventral, abnormal twu34Tg + MO1-hhatla control Fig. 2,  Fig. 5 from Shi et al., 2020
heart myl7 expression increased amount, abnormal twu34Tg + MO1-hhatla control Fig. 3 from Shi et al., 2020
heart nppa expression increased amount, abnormal twu34Tg + MO1-hhatla control Fig. 5 from Shi et al., 2020
heart myh7 expression increased amount, abnormal twu34Tg + MO1-hhatla control Fig. 3 from Shi et al., 2020
post-vent region rough, abnormal twu34Tg + MO1-hhatla control Fig. 2,  Fig. 5 from Shi et al., 2020
heart nppb expression increased amount, abnormal twu34Tg + MO1-hhatla control Fig. 5 from Shi et al., 2020
heart Ab4-atp2a2 labeling decreased amount, abnormal twu34Tg + MO1-hhatla control Fig. 5 from Shi et al., 2020
heart ppp3r1a expression increased amount, abnormal twu34Tg + MO1-hhatla control Fig. 5 from Shi et al., 2020
post-vent region morphology, ameliorated twu34Tg + MO1-hhatla chemical treatment: tacrolimus (anhydrous) Fig. 5 from Shi et al., 2020
heart contraction decreased rate, abnormal twu34Tg + MO1-hhatla control Fig. 2 from Shi et al., 2020
heart morphology, abnormal twu34Tg + MO1-hhatla control Fig. 5 from Shi et al., 2020
post-vent region shortened, abnormal twu34Tg + MO1-hhatla control Fig. 2,  Fig. 5 from Shi et al., 2020
heart atp2a2a expression decreased amount, abnormal twu34Tg + MO1-hhatla control Fig. 5 from Shi et al., 2020
cardiac ventricle decreased functionality, abnormal twu34Tg + MO1-hhatla control Fig. 2 from Shi et al., 2020
cardiac ventricle deformed, abnormal twu34Tg + MO1-hhatla control Fig. 2 from Shi et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.