Morpholino

MO2-tspan18a

ID
ZDB-MRPHLNO-211217-2
Name
MO2-tspan18a
Previous Names
  • E7MO (1)
Target
Sequence
5' - TGTAGAGTCATTGCTGACCTTGTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tspan18a
Phenotype
Phenotype resulting from MO2-tspan18a
Phenotype Fish Figures
blood vessel development delayed, abnormal y1Tg + MO2-tspan18a (TU) Fig. 3. with image from Li et al., 2020
dorsal aorta flt4 expression spatial pattern, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
dorsal longitudinal anastomotic vessel structurally discontinuous, abnormal y1Tg + MO2-tspan18a (TU) Fig. 2. with image from Li et al., 2020
intersegmental vessel absent, abnormal y1Tg + MO2-tspan18a (TU) Fig. 2. with image from Li et al., 2020
intersegmental vessel decreased diameter, abnormal y1Tg + MO2-tspan18a (TU) Fig. 2. with image from Li et al., 2020
intersegmental vessel decreased length, abnormal y1Tg + MO2-tspan18a (TU) Fig. 2. with image from Li et al., 2020
intersegmental vessel retracted, abnormal y1Tg + MO2-tspan18a (TU) Fig. 3. with image from Li et al., 2020
intersegmental vessel spatial pattern, abnormal y1Tg + MO2-tspan18a (TU) Fig. 2. with image from Li et al., 2020
posterior cardinal vein flt4 expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
somite posterior region sema3ab expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
subintestinal vein decreased size, abnormal y1Tg + MO2-tspan18a (TU) Fig. 2. with image from Li et al., 2020
trunk nrp2b expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
trunk nrp1a expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
trunk plxnd1 expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
trunk nrp2a expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
trunk nrp1b expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
trunk artery efnb2b expression absent, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
trunk vein ephb4a expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
trunk vasculature notch3 expression decreased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
trunk vasculature vegfaa expression decreased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
trunk vasculature kdrl expression decreased distribution, abnormal y1Tg + MO2-tspan18a (TU) Fig. 5. with image from Li et al., 2020
Phenotype of all Fish created by or utilizing MO2-tspan18a
Phenotype Fish Conditions Figures
trunk nrp1a expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
intersegmental vessel absent, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 2. with image from Li et al., 2020
trunk vasculature vegfaa expression decreased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
trunk nrp2b expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
trunk artery efnb2b expression absent, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
posterior cardinal vein flt4 expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
blood vessel development delayed, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 3. with image from Li et al., 2020
dorsal aorta flt4 expression spatial pattern, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
dorsal longitudinal anastomotic vessel structurally discontinuous, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 2. with image from Li et al., 2020
trunk vasculature notch3 expression decreased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
intersegmental vessel decreased diameter, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 2. with image from Li et al., 2020
somite posterior region sema3ab expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
subintestinal vein decreased size, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 2. with image from Li et al., 2020
trunk nrp2a expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
trunk plxnd1 expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
trunk vein ephb4a expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
intersegmental vessel decreased length, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 2. with image from Li et al., 2020
intersegmental vessel spatial pattern, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 2. with image from Li et al., 2020
trunk vasculature kdrl expression decreased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
trunk nrp1b expression increased distribution, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 5. with image from Li et al., 2020
intersegmental vessel retracted, abnormal y1Tg + MO2-tspan18a (TU) control Fig. 3. with image from Li et al., 2020
Citations