Morpholino

MO1-mir-ntu1

ID
ZDB-MRPHLNO-210311-1
Name
MO1-mir-ntu1
Previous Names
None
Target
Sequence
5' - GAGGCGTTCAGTCATAATCCCGCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir-ntu1
No data available
Phenotype
Phenotype resulting from MO1-mir-ntu1
Phenotype Fish Figures
blood vessel dll4 expression increased amount, abnormal WT + MO1-mir-ntu1 Fig. 5 from Shi et al., 2019
blood vessel mib1 expression increased amount, abnormal WT + MO1-mir-ntu1 Fig. 5 from Shi et al., 2019
endothelial tip cell endothelial cell proliferation decreased occurrence, abnormal s843Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
endothelial tip cell filopodium decreased amount, abnormal y1Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
endothelial tip cell filopodium decreased length, abnormal y1Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
intersegmental vessel decreased length, abnormal s843Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
intersegmental vessel endothelial tip cell decreased cellular motility, abnormal s843Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
intersegmental vessel endothelial tip cell decreased speed, abnormal s843Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
intersegmental vessel positive regulation of Notch signaling pathway increased magnitude, abnormal zf3185Tg + MO1-mir-ntu1 Fig. 5 from Shi et al., 2019
whole organism mir-ntu1 expression decreased amount, abnormal WT + MO1-mir-ntu1 Fig. 2 from Shi et al., 2019
whole organism dll4 expression increased amount, abnormal WT + MO1-mir-ntu1 Fig. 5 from Shi et al., 2019
whole organism mib1 expression increased amount, abnormal WT + MO1-mir-ntu1 Fig. 5 from Shi et al., 2019
Phenotype of all Fish created by or utilizing MO1-mir-ntu1
Phenotype Fish Conditions Figures
blood vessel dll4 expression increased amount, abnormal WT + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
whole organism mib1 expression increased amount, abnormal WT + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
whole organism mir-ntu1 expression decreased amount, abnormal WT + MO1-mir-ntu1 standard conditions Fig. 2 from Shi et al., 2019
blood vessel mib1 expression increased amount, abnormal WT + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
whole organism dll4 expression increased amount, abnormal WT + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
intersegmental vessel endothelial tip cell decreased speed, abnormal s843Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
endothelial tip cell endothelial cell proliferation decreased occurrence, abnormal s843Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
intersegmental vessel endothelial tip cell decreased cellular motility, abnormal s843Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
intersegmental vessel decreased length, abnormal s843Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
endothelial tip cell filopodium decreased amount, abnormal y1Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
endothelial tip cell filopodium decreased length, abnormal y1Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
intersegmental vessel positive regulation of Notch signaling pathway increased magnitude, abnormal zf3185Tg + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell normal amount, ameliorated s916Tg; y7Tg + MO1-mir-ntu1 chemical treatment by environment: DAPT Fig. 5 from Shi et al., 2019
intersegmental vessel normal length, ameliorated s916Tg; y7Tg + MO1-mir-ntu1 chemical treatment by environment: DAPT Fig. 5 from Shi et al., 2019
intersegmental vessel decreased length, abnormal s916Tg; y7Tg + MO1-mir-ntu1 standard conditions Fig. 2Fig. 5 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal s916Tg; y7Tg + MO1-mir-ntu1 standard conditions Fig. 2Fig. 5 from Shi et al., 2019
intersegmental vessel normal length, ameliorated s916Tg; y7Tg + MO1-dll4 + MO1-mib1 + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell normal amount, ameliorated s916Tg; y7Tg + MO1-dll4 + MO1-mib1 + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
Citations