Morpholino

MO1-apcdd1l

ID
ZDB-MRPHLNO-210305-2
Name
MO1-apcdd1l
Previous Names
None
Target
Sequence
5' - GAATAAGTCTCTCCCCAGCCATGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-apcdd1l
No data available
Phenotype
Phenotype resulting from MO1-apcdd1l
Phenotype Fish Figures
anatomical structure bmp4 expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 5 with image from Vonica et al., 2020
ectoderm tp63 expression decreased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 5 with image from Vonica et al., 2020
hematopoietic system gata1a expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 4 with image from Vonica et al., 2020
integument ionocyte gata3 expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 4 with image from Vonica et al., 2020
neural plate sox19b expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 4 with image from Vonica et al., 2020
neuroectoderm otx2b expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 5 with image from Vonica et al., 2020
notochord tbxta expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 5 with image from Vonica et al., 2020
shield dkk1b expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 5 with image from Vonica et al., 2020
shield gsc expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 4 with image from Vonica et al., 2020
shield chrd expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 5 with image from Vonica et al., 2020
whole organism dorsalized, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 4 with image from Vonica et al., 2020
whole organism ventralized, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 4 with image from Vonica et al., 2020
whole organism ventral region szl expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 4 with image from Vonica et al., 2020
whole organism ventro-lateral region vent expression decreased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 Fig. 5 with image from Vonica et al., 2020
Phenotype of all Fish created by or utilizing MO1-apcdd1l
Phenotype Fish Conditions Figures
neuroectoderm otx2b expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
shield gsc expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
neural plate sox19b expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
whole organism ventro-lateral region vent expression decreased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
shield chrd expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
shield dkk1b expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
integument ionocyte gata3 expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
whole organism ventral region szl expression spatial pattern, ameliorated WT + MO1-apcdd1l + MO4-tp53 chemical treatment by environment: dorsomorphin Fig. 4 with image from Vonica et al., 2020
whole organism dorsalized, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
ectoderm tp63 expression decreased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
hematopoietic system gata1a expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
integument ionocyte gata3 expression spatial pattern, ameliorated WT + MO1-apcdd1l + MO4-tp53 chemical treatment by environment: dorsomorphin Fig. 4 with image from Vonica et al., 2020
whole organism ventral region szl expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 control Fig. 4 with image from Vonica et al., 2020
hematopoietic system gata1a expression spatial pattern, ameliorated WT + MO1-apcdd1l + MO4-tp53 chemical treatment by environment: dorsomorphin Fig. 4 with image from Vonica et al., 2020
notochord tbxta expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
whole organism ventralized, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 4 with image from Vonica et al., 2020
anatomical structure bmp4 expression increased distribution, abnormal WT + MO1-apcdd1l + MO4-tp53 standard conditions Fig. 5 with image from Vonica et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.