Morpholino

MO2-b4galt7

ID
ZDB-MRPHLNO-210111-3
Name
MO2-b4galt7
Previous Names
None
Target
Sequence
5' - TTTCCTCCGTGAAGAGTACATCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-b4galt7
No data available
Phenotype
Phenotype resulting from MO2-b4galt7
Phenotype Fish Figures
ceratohyal cartilage polarity, abnormal AB + MO2-b4galt7 Fig. 4 from Delbaere et al., 2019
cranial cartilage chondrocyte disorganized, abnormal hu5910Tg + MO2-b4galt7 (AB) Fig. 4 from Delbaere et al., 2019
cranial neural crest cell decreased amount, abnormal y1Tg + MO2-b4galt7 (AB) Fig. 4 from Delbaere et al., 2019
cranial neural crest cell disorganized, abnormal y1Tg + MO2-b4galt7 (AB) Fig. 4 from Delbaere et al., 2019
endochondral bone endochondral ossification decreased process quality, abnormal AB + MO2-b4galt7 Fig. 4 from Delbaere et al., 2019
gill filament heparan sulfate decreased distribution, abnormal AB + MO2-b4galt7 Fig. 5 from Delbaere et al., 2019
head decreased length, abnormal AB + MO2-b4galt7 Fig. 3 from Delbaere et al., 2019
intramembranous bone intramembranous ossification decreased process quality, abnormal AB + MO2-b4galt7 Fig. 4 from Delbaere et al., 2019
Meckel's cartilage shape, abnormal AB + MO2-b4galt7 Fig. 4 from Delbaere et al., 2019
palatoquadrate cartilage chondroitin sulfate decreased distribution, abnormal AB + MO2-b4galt7 Fig. 5 from Delbaere et al., 2019
pectoral fin deformed, abnormal AB + MO2-b4galt7 Fig. 3 from Delbaere et al., 2019
pharyngeal arch absent, abnormal AB + MO2-b4galt7 Fig. 4 from Delbaere et al., 2019
pharyngeal arch decreased size, abnormal AB + MO2-b4galt7 Fig. 3 from Delbaere et al., 2019
post-vent region decreased length, abnormal AB + MO2-b4galt7 Fig. 3 from Delbaere et al., 2019
post-vent region actin filament disorganized, abnormal AB + MO2-b4galt7 Fig. 6 from Delbaere et al., 2019
trunk decreased length, abnormal AB + MO2-b4galt7 Fig. 3 from Delbaere et al., 2019
whole organism decreased length, abnormal AB + MO2-b4galt7 Fig. 3 from Delbaere et al., 2019
whole organism hatching behavior decreased process quality, abnormal AB + MO2-b4galt7 Fig. 6 from Delbaere et al., 2019
whole organism sulfated glycosaminoglycan decreased amount, abnormal AB + MO2-b4galt7 Fig. 5 from Delbaere et al., 2019
whole organism thigmotaxis decreased process quality, abnormal AB + MO2-b4galt7 Fig. 6 from Delbaere et al., 2019
Phenotype of all Fish created by or utilizing MO2-b4galt7
Phenotype Fish Conditions Figures
whole organism hatching behavior decreased process quality, abnormal AB + MO2-b4galt7 control Fig. 6 from Delbaere et al., 2019
pectoral fin deformed, abnormal AB + MO2-b4galt7 control Fig. 3 from Delbaere et al., 2019
intramembranous bone intramembranous ossification decreased process quality, abnormal AB + MO2-b4galt7 control Fig. 4 from Delbaere et al., 2019
head decreased length, abnormal AB + MO2-b4galt7 control Fig. 3 from Delbaere et al., 2019
palatoquadrate cartilage chondroitin sulfate decreased distribution, abnormal AB + MO2-b4galt7 control Fig. 5 from Delbaere et al., 2019
whole organism decreased length, abnormal AB + MO2-b4galt7 control Fig. 3 from Delbaere et al., 2019
whole organism sulfated glycosaminoglycan decreased amount, abnormal AB + MO2-b4galt7 control Fig. 5 from Delbaere et al., 2019
Meckel's cartilage shape, abnormal AB + MO2-b4galt7 control Fig. 4 from Delbaere et al., 2019
pharyngeal arch absent, abnormal AB + MO2-b4galt7 control Fig. 4 from Delbaere et al., 2019
ceratohyal cartilage polarity, abnormal AB + MO2-b4galt7 control Fig. 4 from Delbaere et al., 2019
endochondral bone endochondral ossification decreased process quality, abnormal AB + MO2-b4galt7 control Fig. 4 from Delbaere et al., 2019
gill filament heparan sulfate decreased distribution, abnormal AB + MO2-b4galt7 control Fig. 5 from Delbaere et al., 2019
whole organism thigmotaxis decreased process quality, abnormal AB + MO2-b4galt7 control Fig. 6 from Delbaere et al., 2019
post-vent region decreased length, abnormal AB + MO2-b4galt7 control Fig. 3 from Delbaere et al., 2019
trunk decreased length, abnormal AB + MO2-b4galt7 control Fig. 3 from Delbaere et al., 2019
pharyngeal arch decreased size, abnormal AB + MO2-b4galt7 control Fig. 3 from Delbaere et al., 2019
post-vent region actin filament disorganized, abnormal AB + MO2-b4galt7 control Fig. 6 from Delbaere et al., 2019
cranial cartilage chondrocyte disorganized, abnormal hu5910Tg + MO2-b4galt7 (AB) control Fig. 4 from Delbaere et al., 2019
cranial neural crest cell decreased amount, abnormal y1Tg + MO2-b4galt7 (AB) control Fig. 4 from Delbaere et al., 2019
cranial neural crest cell disorganized, abnormal y1Tg + MO2-b4galt7 (AB) control Fig. 4 from Delbaere et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.