Morpholino

MO6-gja1b

ID
ZDB-MRPHLNO-201130-2
Name
MO6-gja1b
Previous Names
None
Target
Sequence
5' - TCCCAACGCACTCCAGTCACCCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-gja1b
No data available
Phenotype
Phenotype resulting from MO6-gja1b
Phenotype of all Fish created by or utilizing MO6-gja1b
Phenotype Fish Conditions Figures
spinal cord has number of ependymal cell motile cilium, ameliorated AB + MO6-gja1b chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 4 with image from Zhang et al., 2020
ependymal cell motile cilium assembly occurrence, ameliorated AB + MO6-gja1b chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 4 with image from Zhang et al., 2020
ependymal cell motile cilium assembly decreased occurrence, abnormal AB + MO6-gja1b standard conditions Fig. 3 with imageFig. 4 with image from Zhang et al., 2020
central canal cerebrospinal fluid circulation decreased process quality, abnormal AB + MO6-gja1b standard conditions Fig. 3 with image from Zhang et al., 2020
spinal cord has fewer parts of type ependymal cell motile cilium, abnormal AB + MO6-gja1b standard conditions Fig. 3 with imageFig. 4 with image from Zhang et al., 2020
heart contraction decreased rate, abnormal AB/TU + MO6-gja1b standard conditions Fig. 5 with imageFig. 6 with image from Rattka et al., 2021
pericardium edematous, abnormal AB/TU + MO6-gja1b standard conditions Fig. 5 with image from Rattka et al., 2021
heart decreased functionality, abnormal AB/TU + MO6-gja1b standard conditions Fig. 6 with image from Rattka et al., 2021
cardiac ventricle decreased contractility, abnormal AB/TU + MO6-gja1b standard conditions Fig. 6 with image from Rattka et al., 2021
spinal cord ependymal cell GCaMP expression decreased amount, abnormal cms5Tg + MO6-gja1b standard conditions Fig. 4 with image from Zhang et al., 2020
ependymal cell calcium-mediated signaling decreased occurrence, abnormal cms5Tg + MO6-gja1b standard conditions Fig. 4 with image from Zhang et al., 2020
ependymal cell calcium-mediated signaling occurrence, ameliorated cms5Tg + MO6-gja1b chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 4 with image from Zhang et al., 2020
ependymal cell cilium movement decreased occurrence, abnormal hsc5Tg + MO6-gja1b standard conditions Fig. 3 with image from Zhang et al., 2020
heart decreased functionality, abnormal AB/TU + MO2-spen + MO6-gja1b standard conditions Fig. 7 with image from Rattka et al., 2021
pericardium edematous, abnormal AB/TU + MO2-spen + MO6-gja1b standard conditions Fig. 7 with image from Rattka et al., 2021
Citations