Morpholino

MO2-tnnt1

ID

ZDB-MRPHLNO-201103-2

Name

MO2-tnnt1

Previous Names

None

Target

tnnt1 (1)

Sequence

5' - CCTGTAATGTGGAGGACAAAAGCAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tnnt1

Expressed Gene	Anatomy	Figures
tnnt1	whole organism	Fig. 6 from Pellerin et al., 2020

Phenotype

Phenotype resulting from MO2-tnnt1

Phenotype	Fish	Figures
fast muscle cell sarcomere disorganized, abnormal	WT + MO2-tnnt1	Fig. 7 from Pellerin et al., 2020
fast muscle cell Z disc increased thickness, abnormal	WT + MO2-tnnt1	Fig. 7 from Pellerin et al., 2020
muscle decreased mass, abnormal	WT + MO2-tnnt1	Fig. 5 from Pellerin et al., 2020
muscle morphology, abnormal	WT + MO2-tnnt1	Fig. 5 from Pellerin et al., 2020
skeletal muscle morphology, abnormal	AB + MO2-tnnt1	Fig. 3 from Lee et al., 2021
skeletal muscle refractivity, abnormal	AB + MO2-tnnt1	Fig. 3 from Lee et al., 2021
skeletal muscle cell disorganized, abnormal	WT + MO2-tnnt1	Fig. 5 from Pellerin et al., 2020
skeletal muscle cell increased distance skeletal muscle cell, abnormal	WT + MO2-tnnt1	Fig. 5 from Pellerin et al., 2020
slow muscle cell sarcomere disorganized, abnormal	WT + MO2-tnnt1	Fig. 7 from Pellerin et al., 2020
slow muscle cell Z disc increased thickness, abnormal	WT + MO2-tnnt1	Fig. 7 from Pellerin et al., 2020
trunk increased curvature, abnormal	WT + MO2-tnnt1	Fig. 5 from Pellerin et al., 2020
whole organism curved ventral, abnormal	AB + MO2-tnnt1	Fig. 3 from Lee et al., 2021
whole organism tnnt1 expression decreased amount, abnormal	WT + MO2-tnnt1	Fig. 6 from Pellerin et al., 2020
whole organism immobile, abnormal	AB + MO2-tnnt1	Fig. 3 from Lee et al., 2021
whole organism increased curvature, abnormal	AB + MO2-tnnt1	Fig. 3 from Lee et al., 2021

Phenotype of all Fish created by or utilizing MO2-tnnt1

Phenotype	Fish	Conditions	Figures
whole organism curved ventral, abnormal	AB + MO2-tnnt1	standard conditions	Fig. 3 from Lee et al., 2021
skeletal muscle refractivity, abnormal	AB + MO2-tnnt1	standard conditions	Fig. 3 from Lee et al., 2021
skeletal muscle morphology, abnormal	AB + MO2-tnnt1	standard conditions	Fig. 3 from Lee et al., 2021
whole organism increased curvature, abnormal	AB + MO2-tnnt1	standard conditions	Fig. 3 from Lee et al., 2021
whole organism immobile, abnormal	AB + MO2-tnnt1	standard conditions	Fig. 3 from Lee et al., 2021
slow muscle cell Z disc increased thickness, abnormal	WT + MO2-tnnt1	standard conditions	Fig. 7 from Pellerin et al., 2020
fast muscle cell Z disc increased thickness, abnormal	WT + MO2-tnnt1	standard conditions	Fig. 7 from Pellerin et al., 2020
muscle decreased mass, abnormal	WT + MO2-tnnt1	standard conditions	Fig. 5 from Pellerin et al., 2020
skeletal muscle cell disorganized, abnormal	WT + MO2-tnnt1	standard conditions	Fig. 5 from Pellerin et al., 2020
whole organism tnnt1 expression decreased amount, abnormal	WT + MO2-tnnt1	standard conditions	Fig. 6 from Pellerin et al., 2020
trunk increased curvature, abnormal	WT + MO2-tnnt1	standard conditions	Fig. 5 from Pellerin et al., 2020
muscle morphology, abnormal	WT + MO2-tnnt1	standard conditions	Fig. 5 from Pellerin et al., 2020
slow muscle cell sarcomere disorganized, abnormal	WT + MO2-tnnt1	standard conditions	Fig. 7 from Pellerin et al., 2020
skeletal muscle cell increased distance skeletal muscle cell, abnormal	WT + MO2-tnnt1	standard conditions	Fig. 5 from Pellerin et al., 2020
fast muscle cell sarcomere disorganized, abnormal	WT + MO2-tnnt1	standard conditions	Fig. 7 from Pellerin et al., 2020
whole organism Ab2-tnnt2 labeling decreased amount, abnormal	mitfa^w2/w2; mpv17^a9/a9 + MO2-tnnt1	standard conditions	Fig. 6 from Pellerin et al., 2020

Citations