Morpholino

MO2-twist2

ID

ZDB-MRPHLNO-201014-4

Name

MO2-twist2

Previous Names

None

Target

twist2 (1)

Sequence

5' - AATACGATCTCCACTTTTGGTTCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-twist2

No data available

Phenotype

Phenotype resulting from MO2-twist2

Phenotype	Fish	Figures
dorsal oblique extraocular muscle position, abnormal	zf13Tg + MO2-twist2	Fig. S3 from Zhao et al., 2020
extraocular musculature lacks parts or has fewer parts of type dorsal rectus, abnormal	zf13Tg + MO2-twist2	Fig. S3 from Zhao et al., 2020
extraocular musculature lacks parts or has fewer parts of type lateral rectus, abnormal	zf13Tg + MO2-twist2	Fig. S3 from Zhao et al., 2020
extraocular musculature position, abnormal	zf13Tg + MO2-twist2	Fig. S2 from Zhao et al., 2020
eye decreased size, abnormal	zf13Tg + MO2-twist2	Fig. S2 , Fig. S3 from Zhao et al., 2020
head decreased size, abnormal	zf13Tg + MO2-twist2	Fig. S3 from Zhao et al., 2020
head muscle decreased amount, abnormal	zf13Tg + MO2-twist2	Fig. S3 from Zhao et al., 2020
head muscle morphology, abnormal	zf13Tg + MO2-twist2	Fig. S2 , Fig. S3 from Zhao et al., 2020
pericardium edematous, abnormal	zf13Tg + MO2-twist2	Fig. S2 from Zhao et al., 2020
post-vent region morphology, abnormal	zf13Tg + MO2-twist2	Fig. S2 from Zhao et al., 2020
trunk morphology, abnormal	zf13Tg + MO2-twist2	Fig. S2 from Zhao et al., 2020

Phenotype of all Fish created by or utilizing MO2-twist2

Phenotype	Fish	Conditions	Figures
extraocular musculature lacks parts or has fewer parts of type dorsal rectus, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S3 from Zhao et al., 2020
trunk morphology, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S2 from Zhao et al., 2020
head muscle morphology, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S2 , Fig. S3 from Zhao et al., 2020
post-vent region morphology, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S2 from Zhao et al., 2020
pericardium edematous, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S2 from Zhao et al., 2020
head muscle decreased amount, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S3 from Zhao et al., 2020
dorsal oblique extraocular muscle position, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S3 from Zhao et al., 2020
eye decreased size, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S2 , Fig. S3 from Zhao et al., 2020
head decreased size, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S3 from Zhao et al., 2020
extraocular musculature position, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S2 from Zhao et al., 2020
extraocular musculature lacks parts or has fewer parts of type lateral rectus, abnormal	zf13Tg + MO2-twist2	standard conditions	Fig. S3 from Zhao et al., 2020
lateral rectus regenerating tissue decreased size, abnormal	zf13Tg + MO2-twist1a + MO2-twist2 + MO3-twist3 + MO4-twist1b	resection: lateral rectus	Fig. 1 from Zhao et al., 2020
skeletal muscle tissue regeneration disrupted, abnormal	zf13Tg + MO2-twist1a + MO2-twist2 + MO3-twist3 + MO4-twist1b	resection: lateral rectus	Fig. 1 from Zhao et al., 2020

Citations