Morpholino

MO2-gaa

ID
ZDB-MRPHLNO-200918-2
Name
MO2-gaa
Previous Names
  • I9E10gaa-MO (1)
Target
Sequence
5' - ATGTCCTGTAAACAAGAAAATCACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gaa
No data available
Phenotype
Phenotype resulting from MO2-gaa
Phenotype Fish Figures
cardiac jelly increased amount, abnormal WT + MO2-gaa Fig. 1 from Bragato et al., 2020
fourth ventricle increased size, abnormal WT + MO2-gaa Fig. 1 from Bragato et al., 2020
heart edematous, abnormal WT + MO2-gaa Fig. 1 from Bragato et al., 2020
motor behavior decreased process quality, abnormal AB + MO2-gaa Fig. 4 with image from Cinzia et al., 2021
muscle cell extracellular region increased amount, abnormal WT + MO2-gaa Fig. 1Fig. 4 from Bragato et al., 2020
muscle cell glycogen granule increased amount, abnormal WT + MO2-gaa Fig. 1Fig. 4 from Bragato et al., 2020
muscle cell lysosome increased amount, abnormal WT + MO2-gaa Fig. 1 from Bragato et al., 2020
pericardial muscle extracellular region increased amount, abnormal WT + MO2-gaa Fig. 1 from Bragato et al., 2020
pericardial muscle lipid droplet increased amount, abnormal WT + MO2-gaa Fig. 1 from Bragato et al., 2020
somite cholinergic synapse swollen, abnormal AB + MO2-gaa Fig. 3 with image from Cinzia et al., 2021
somite neuromuscular junction convolute, abnormal AB + MO2-gaa Fig. 3 with image from Cinzia et al., 2021
somite neuromuscular junction structure, abnormal AB + MO2-gaa Fig. 3 with image from Cinzia et al., 2021
somite neuromuscular junction swollen, abnormal AB + MO2-gaa Fig. 3 with image from Cinzia et al., 2021
somite skeletal muscle acetylcholine-gated channel clustering decreased process quality, abnormal AB + MO2-gaa Fig. 1 with image from Cinzia et al., 2021
somite synaptic vesicle decreased amount, abnormal AB + MO2-gaa Fig. 3 with image from Cinzia et al., 2021
whole organism becn1 expression increased amount, abnormal WT + MO2-gaa Fig. 2Fig. 7 from Bragato et al., 2020
whole organism sqstm1 expression increased amount, abnormal WT + MO2-gaa Fig. 2Fig. 7 from Bragato et al., 2020
whole organism map1lc3b expression increased amount, abnormal WT + MO2-gaa Fig. 2Fig. 7 from Bragato et al., 2020
whole organism morphology, abnormal WT + MO2-gaa Fig. 1 from Bragato et al., 2020
whole organism glycogen granule increased amount, abnormal WT + MO2-gaa Fig. 1 from Bragato et al., 2020
Phenotype of all Fish created by or utilizing MO2-gaa
Phenotype Fish Conditions Figures
somite neuromuscular junction structure, ameliorated AB + MO2-gaa chemical treatment by environment: amifampridine Fig. 3 with image from Cinzia et al., 2021
somite cholinergic synapse structure, ameliorated AB + MO2-gaa chemical treatment by environment: amifampridine Fig. 3 with image from Cinzia et al., 2021
somite synaptic vesicle decreased amount, abnormal AB + MO2-gaa control Fig. 3 with image from Cinzia et al., 2021
somite neuromuscular junction swollen, abnormal AB + MO2-gaa control Fig. 3 with image from Cinzia et al., 2021
somite neuromuscular junction structure, abnormal AB + MO2-gaa control Fig. 3 with image from Cinzia et al., 2021
somite synaptic vesicle amount, ameliorated AB + MO2-gaa chemical treatment by environment: amifampridine Fig. 3 with image from Cinzia et al., 2021
somite neuromuscular junction convolute, abnormal AB + MO2-gaa control Fig. 3 with image from Cinzia et al., 2021
somite skeletal muscle acetylcholine-gated channel clustering process quality, ameliorated AB + MO2-gaa chemical treatment by environment: amifampridine Fig. 1 with image from Cinzia et al., 2021
somite cholinergic synapse swollen, abnormal AB + MO2-gaa control Fig. 3 with image from Cinzia et al., 2021
motor behavior decreased process quality, abnormal AB + MO2-gaa control Fig. 4 with image from Cinzia et al., 2021
somite skeletal muscle acetylcholine-gated channel clustering decreased process quality, abnormal AB + MO2-gaa control Fig. 1 with image from Cinzia et al., 2021
motor behavior process quality, ameliorated AB + MO2-gaa chemical treatment by environment: amifampridine Fig. 4 with image from Cinzia et al., 2021
whole organism sqstm1 expression increased amount, abnormal WT + MO2-gaa standard conditions Fig. 2Fig. 7 from Bragato et al., 2020
whole organism sqstm1 expression increased amount, abnormal WT + MO2-gaa chemical treatment: 3-bromopyruvate Fig. 7 from Bragato et al., 2020
whole organism map1lc3b expression increased amount, abnormal WT + MO2-gaa standard conditions Fig. 2Fig. 7 from Bragato et al., 2020
cardiac jelly increased amount, abnormal WT + MO2-gaa standard conditions Fig. 1 from Bragato et al., 2020
whole organism becn1 expression increased amount, abnormal WT + MO2-gaa standard conditions Fig. 2Fig. 7 from Bragato et al., 2020
whole organism morphology, abnormal WT + MO2-gaa standard conditions Fig. 1 from Bragato et al., 2020
heart edematous, abnormal WT + MO2-gaa standard conditions Fig. 1 from Bragato et al., 2020
muscle cell glycogen granule increased amount, ameliorated WT + MO2-gaa chemical treatment: 3-bromopyruvate Fig. 4 from Bragato et al., 2020
muscle cell lysosome increased amount, abnormal WT + MO2-gaa standard conditions Fig. 1 from Bragato et al., 2020
whole organism glycogen granule increased amount, abnormal WT + MO2-gaa standard conditions Fig. 1 from Bragato et al., 2020
muscle cell glycogen granule increased amount, abnormal WT + MO2-gaa standard conditions Fig. 1Fig. 4 from Bragato et al., 2020
muscle cell lysosome increased amount, abnormal WT + MO2-gaa chemical treatment: chemical tracer Fig. 5 from Bragato et al., 2020
muscle cell extracellular region increased amount, abnormal WT + MO2-gaa standard conditions Fig. 1Fig. 4 from Bragato et al., 2020
muscle cell extracellular region increased amount, ameliorated WT + MO2-gaa chemical treatment: 3-bromopyruvate Fig. 4 from Bragato et al., 2020
whole organism map1lc3b expression increased amount, abnormal WT + MO2-gaa chemical treatment: 3-bromopyruvate Fig. 7 from Bragato et al., 2020
muscle cell lysosome increased amount, abnormal WT + MO2-gaa chemical treatment: 3-bromopyruvate, chemical treatment: DND-99 dye Fig. 5 from Bragato et al., 2020
whole organism glycogen granule increased amount, abnormal WT + MO2-gaa chemical treatment: chemical tracer Fig. 1 from Bragato et al., 2020
fourth ventricle increased size, abnormal WT + MO2-gaa standard conditions Fig. 1 from Bragato et al., 2020
pericardial muscle lipid droplet increased amount, abnormal WT + MO2-gaa standard conditions Fig. 1 from Bragato et al., 2020
pericardial muscle extracellular region increased amount, abnormal WT + MO2-gaa standard conditions Fig. 1 from Bragato et al., 2020
Citations