Morpholino

MO1-adpgk

ID
ZDB-MRPHLNO-200407-1
Name
MO1-adpgk
Previous Names
  • exon 2 and intron 2 junction (1)
Target
Sequence
5' - GTGTTCTCCAAGTTGCTCACCCCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 25
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adpgk
Phenotype
Phenotype resulting from MO1-adpgk
Phenotype of all Fish created by or utilizing MO1-adpgk
Phenotype Fish Conditions Figures
whole organism glucose decreased amount, abnormal AB + MO1-adpgk standard conditions Figure 6 with image from Imle et al., 2019
whole organism ins expression decreased amount, abnormal AB + MO1-adpgk standard conditions Figure 6 with image from Imle et al., 2019
whole organism morphology, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
whole organism bcl2l1 expression decreased amount, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
respiratory electron transport chain process quality, abnormal AB + MO1-adpgk standard conditions Fig. S2 from Imle et al., 2019
whole organism cell death increased occurrence, abnormal AB + MO1-adpgk standard conditions Fig. S2 from Imle et al., 2019
whole organism bbc3 expression increased amount, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
carbohydrate derivative metabolic process decreased occurrence, abnormal AB + MO1-adpgk standard conditions Fig. S2 from Imle et al., 2019
somite shape, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
whole organism cdkn1a expression increased amount, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
whole organism decreased length, abnormal AB + MO1-adpgk standard conditions Fig. S2Figure 5 with image from Imle et al., 2019
whole organism apoptotic process increased occurrence, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
whole organism dorsalized, abnormal AB + MO1-adpgk standard conditions Fig. S2Figure 5 with image from Imle et al., 2019
whole organism gadd45aa expression increased amount, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
whole organism decreased length, abnormal AB + MO1-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
whole organism dorsalized, abnormal AB + MO1-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
Citations