Morpholino

MO3-vgll4l

ID
ZDB-MRPHLNO-200323-1
Name
MO3-vgll4l
Previous Names
None
Target
Sequence
5' - TGTAGTGGAAATTAGTGACCGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-vgll4l
Expressed Gene Anatomy Figures
abcc6a Figure 4 with image from Fillatre et al., 2019
atp6ap1b Figure 4 with image from Fillatre et al., 2019
cdc14aa Figure 4 with image from Fillatre et al., 2019
cfap45 Figure 4 with image from Fillatre et al., 2019
cftr Figure 4 with image from Fillatre et al., 2019
cldn5a Figure 4 with image from Fillatre et al., 2019
daw1 Figure 4 with image from Fillatre et al., 2019
dhrs13a.1 Figure 4 with image from Fillatre et al., 2019
dnaaf4 Figure 4 with image from Fillatre et al., 2019
dnmt3bb.1 Figure 4 with image from Fillatre et al., 2019
dnmt3bb.2 Figure 4 with image from Fillatre et al., 2019
mbd3b Figure 4 with image from Fillatre et al., 2019
ndr1 Figure 4 with image from Fillatre et al., 2019
nme5 Figure 4 with image from Fillatre et al., 2019
odad4 Figure 4 with image from Fillatre et al., 2019
quo Figure 4 with image from Fillatre et al., 2019
rasgef1ba Figure 4 with image from Fillatre et al., 2019
rassf7b Figure 4 with image from Fillatre et al., 2019
si:ch73-364h19.1 Figure 4 with image from Fillatre et al., 2019
slc35d1a Figure 4 with image from Fillatre et al., 2019
sypl2b Figure 4 with image from Fillatre et al., 2019
tekt1 Figure 4 with image from Fillatre et al., 2019
tnfrsf21 Figure 4 with image from Fillatre et al., 2019
vgll4l Figure 4 with image from Fillatre et al., 2019
Phenotype
Phenotype resulting from MO3-vgll4l
Phenotype Fish Figures
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO3-vgll4l Figure 1 with imageFigure 9 from Fillatre et al., 2019
forerunner cell group dnaaf4 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group dhrs13a.1 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cfap45 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group si:ch73-364h19.1 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group ndr1 expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cldn5a expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cftr expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group quo expression absent, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group atp6ap1b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group vgll4l expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group cdc14aa expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group sypl2b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group tnfrsf21 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnmt3bb.2 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnmt3bb.1 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group rassf7b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group odad4 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group slc35d1a expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group mbd3b expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group abcc6a expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group rasgef1ba expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group nme5 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group tekt1 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group daw1 expression decreased amount, abnormal AB/TU + MO3-vgll4l Figure 4 with image from Fillatre et al., 2019
forerunner cell group DNA-methyltransferase activity decreased occurrence, abnormal s870Tg + MO3-vgll4l Figure 10 from Fillatre et al., 2019
forerunner cell group nucleus ab1-5-mc labeling decreased amount, abnormal s870Tg + MO3-vgll4l Figure 10 from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO3-vgll4l Figure 1 with imageFigure 9 from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO3-vgll4l Figure 1 with imageFigure 9 from Fillatre et al., 2019
Phenotype of all Fish created by or utilizing MO3-vgll4l
Phenotype Fish Conditions Figures
forerunner cell group atp6ap1b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO3-vgll4l standard conditions Figure 1 with imageFigure 9 from Fillatre et al., 2019
forerunner cell group cldn5a expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group rasgef1ba expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnaaf4 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group sypl2b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group cftr expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group mbd3b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group daw1 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group vgll4l expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group dnmt3bb.1 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group rassf7b expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group odad4 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group cdc14aa expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group slc35d1a expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group abcc6a expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO3-vgll4l standard conditions Figure 1 with imageFigure 9 from Fillatre et al., 2019
forerunner cell group dnmt3bb.2 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group cfap45 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group si:ch73-364h19.1 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group quo expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO3-vgll4l standard conditions Figure 1 with imageFigure 9 from Fillatre et al., 2019
forerunner cell group tekt1 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group nme5 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group tnfrsf21 expression decreased amount, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group ndr1 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group dhrs13a.1 expression absent, abnormal AB/TU + MO3-vgll4l standard conditions Figure 4 with image from Fillatre et al., 2019
forerunner cell group decreased amount, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 2 with imageFigure 9 from Fillatre et al., 2019
Kupffer's vesicle decreased size, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 2 with imageFigure 9 from Fillatre et al., 2019
forerunner cell group apoptotic process increased occurrence, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 2 with imageFigure 9 from Fillatre et al., 2019
Kupffer's vesicle motile cilium decreased length, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 3 with imageFigure 9 from Fillatre et al., 2019
forerunner cell group cell population proliferation decreased occurrence, abnormal AB/TU + MO3-vgll4l + MO4-vgll4l standard conditions Figure 9 from Fillatre et al., 2019
forerunner cell group DNA-methyltransferase activity decreased occurrence, abnormal s870Tg + MO3-vgll4l standard conditions Figure 10 from Fillatre et al., 2019
forerunner cell group nucleus ab1-5-mc labeling decreased amount, abnormal s870Tg + MO3-vgll4l standard conditions Figure 10 from Fillatre et al., 2019
Citations