Morpholino

MO1-nampt1

ID
ZDB-MRPHLNO-200320-1
Name
MO1-nampt1
Previous Names
None
Target
Sequence
5' - TGTGTGACCTGCAATGAAAGAAAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nampt1
No data available
Phenotype
Phenotype resulting from MO1-nampt1
Phenotype Fish Figures
blood island hematopoietic stem cell decreased amount, abnormal cz3331Tg + MO1-nampt1 Fig. 7 from Morishima et al., 2019
blood island hematopoietic stem cell EGFP expression decreased amount, abnormal cz3331Tg + MO1-nampt1 Fig. 7 from Morishima et al., 2019
extension morphology, abnormal cz3331Tg + MO1-nampt1 Fig. 2 with image from Pomreinke et al., 2024
eye decreased size, abnormal cz3331Tg + MO1-nampt1 Fig. 2 with image from Pomreinke et al., 2024
head decreased size, abnormal cz3331Tg + MO1-nampt1 Fig. 2 with image from Pomreinke et al., 2024
notochord inner cell increased size, abnormal cz3331Tg + MO1-nampt1 Fig. 2 with image from Pomreinke et al., 2024
notochord inner cell vacuolated, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 Fig. 2 with image from Pomreinke et al., 2024
post-vent region curved, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 Fig. 2 with image from Pomreinke et al., 2024
post-vent region morphology, abnormal WT + MO1-nampt1 Fig. S7 from Morishima et al., 2019
somite shape, abnormal cz3331Tg + MO1-nampt1 Fig. 2 with image from Pomreinke et al., 2024
whole organism gata1a expression decreased amount, abnormal cz3331Tg + MO1-nampt1 Fig. 4 with image from Pomreinke et al., 2024
Fig. 7 from Morishima et al., 2019
whole organism kdrl expression decreased amount, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 Fig. 4 with image from Pomreinke et al., 2024
Fig. 7 from Morishima et al., 2019
whole organism klf1 expression decreased amount, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 Fig. 4 with image from Pomreinke et al., 2024
Fig. 7 from Morishima et al., 2019
whole organism decreased length, abnormal cz3331Tg + MO1-nampt1 Fig. 2 with image from Pomreinke et al., 2024
whole organism NAD(+) decreased amount, abnormal cz3331Tg + MO1-nampt1 Fig. 2 with image from Pomreinke et al., 2024
Fig. S7 from Morishima et al., 2019
yolk broken, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 Fig. 2 with image from Pomreinke et al., 2024
Phenotype of all Fish created by or utilizing MO1-nampt1
Phenotype Fish Conditions Figures
whole organism gata1a expression decreased amount, abnormal WT + MO1-nampt1 standard conditions Fig. 7 from Morishima et al., 2019
whole organism kdrl expression decreased amount, abnormal WT + MO1-nampt1 standard conditions Fig. 7 from Morishima et al., 2019
whole organism NAD(+) decreased amount, abnormal WT + MO1-nampt1 standard conditions Fig. S7 from Morishima et al., 2019
post-vent region morphology, abnormal WT + MO1-nampt1 standard conditions Fig. S7 from Morishima et al., 2019
whole organism klf1 expression decreased amount, abnormal WT + MO1-nampt1 standard conditions Fig. 7 from Morishima et al., 2019
blood island hematopoietic stem cell EGFP expression decreased amount, abnormal cz3331Tg + MO1-nampt1 standard conditions Fig. 7 from Morishima et al., 2019
eye decreased size, abnormal cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
notochord inner cell increased size, abnormal cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
whole organism gata1a expression decreased amount, abnormal cz3331Tg + MO1-nampt1 control Fig. 4 with image from Pomreinke et al., 2024
somite shape, abnormal cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
whole organism kdrl expression decreased amount, abnormal cz3331Tg + MO1-nampt1 control Fig. 4 with image from Pomreinke et al., 2024
whole organism NAD(+) decreased amount, abnormal cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
post-vent region curved, abnormal cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
notochord inner cell vacuolated, abnormal cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
extension morphology, abnormal cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
whole organism decreased length, abnormal cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
head decreased size, abnormal cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
blood island hematopoietic stem cell decreased amount, abnormal cz3331Tg + MO1-nampt1 standard conditions Fig. 7 from Morishima et al., 2019
yolk broken, abnormal cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
whole organism klf1 expression decreased amount, abnormal cz3331Tg + MO1-nampt1 control Fig. 4 with image from Pomreinke et al., 2024
whole organism kdrl expression decreased amount, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 4 with image from Pomreinke et al., 2024
whole organism klf1 expression decreased amount, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 4 with image from Pomreinke et al., 2024
yolk broken, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
somite shape, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
whole organism NAD(+) decreased amount, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
whole organism decreased length, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
notochord inner cell increased size, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
head decreased size, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
extension morphology, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
eye decreased size, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
post-vent region curved, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
notochord inner cell vacuolated, abnormal nampt1t10pm/t10pm; cz3331Tg + MO1-nampt1 control Fig. 2 with image from Pomreinke et al., 2024
Citations