Morpholino

MO2-rgma

ID

ZDB-MRPHLNO-200318-1

Name

MO2-rgma

Previous Names

rgma AUG MO2 (1)

Target

rgma (1)

Sequence

5' - CTCTCCTCTCCCTTTTTGAATGCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-rgma

No data available

Phenotype

Phenotype resulting from MO2-rgma

Phenotype	Fish	Figures
brain morphology, abnormal	AB + MO2-rgma	Fig. 2 from Brown et al., 2019
eye decreased size, abnormal	AB + MO2-rgma	Fig. 2 from Brown et al., 2019
hindbrain neural keel cell morphogenesis process quality, abnormal	AB + MO2-rgma	Fig. 3 from Brown et al., 2019
hindbrain neural keel microtubule disorganized, abnormal	AB + MO2-rgma	Fig. 9 from Brown et al., 2019
hindbrain neural keel microtubule mislocalised, abnormal	AB + MO2-rgma	Fig. 9 from Brown et al., 2019
hindbrain neural keel microtubule shortened, abnormal	AB + MO2-rgma	Fig. 9 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell circular, abnormal	AB + MO2-rgma	Fig. 3 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell shape, abnormal	AB + MO2-rgma	Fig. 3 from Brown et al., 2019
hindbrain neural rod cell division process quality, abnormal	AB + MO2-rgma	Fig. 7 from Brown et al., 2019
neural plate increased width, abnormal	AB + MO2-rgma	Fig. 6 from Brown et al., 2019
neural tube duplicated, abnormal	AB + MO2-rgma	Fig. 8 from Brown et al., 2019
neuroepithelial cell cell morphogenesis process quality, abnormal	AB + MO2-rgma	Fig. 3 from Brown et al., 2019
somite morphology, abnormal	AB + MO2-rgma	Fig. 2 from Brown et al., 2019
whole organism decreased pigmentation, abnormal	AB + MO2-rgma	Fig. 2 from Brown et al., 2019
whole organism anterior-posterior axis shortened, abnormal	AB + MO2-rgma	Fig. 2 from Brown et al., 2019

Phenotype of all Fish created by or utilizing MO2-rgma

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	AB + MO2-rgma	standard conditions	Fig. 2 from Brown et al., 2019
hindbrain neural keel microtubule shortened, abnormal	AB + MO2-rgma	standard conditions	Fig. 9 from Brown et al., 2019
hindbrain neural keel microtubule disorganized, abnormal	AB + MO2-rgma	standard conditions	Fig. 9 from Brown et al., 2019
hindbrain neural keel cell morphogenesis process quality, abnormal	AB + MO2-rgma	control	Fig. 3 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell shape, abnormal	AB + MO2-rgma	control	Fig. 3 from Brown et al., 2019
hindbrain neural rod cell division process quality, abnormal	AB + MO2-rgma	control	Fig. 7 from Brown et al., 2019
whole organism anterior-posterior axis shortened, abnormal	AB + MO2-rgma	standard conditions	Fig. 2 from Brown et al., 2019
hindbrain neural keel microtubule mislocalised, abnormal	AB + MO2-rgma	standard conditions	Fig. 9 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell circular, abnormal	AB + MO2-rgma	control	Fig. 3 from Brown et al., 2019
neural tube duplicated, abnormal	AB + MO2-rgma	standard conditions	Fig. 8 from Brown et al., 2019
somite morphology, abnormal	AB + MO2-rgma	standard conditions	Fig. 2 from Brown et al., 2019
neural plate increased width, abnormal	AB + MO2-rgma	standard conditions	Fig. 6 from Brown et al., 2019
whole organism decreased pigmentation, abnormal	AB + MO2-rgma	standard conditions	Fig. 2 from Brown et al., 2019
neuroepithelial cell cell morphogenesis process quality, abnormal	AB + MO2-rgma	control	Fig. 3 from Brown et al., 2019
brain morphology, abnormal	AB + MO2-rgma	standard conditions	Fig. 2 from Brown et al., 2019

Citations