Morpholino

MO1-fndc3a

ID
ZDB-MRPHLNO-200313-1
Name
MO1-fndc3a
Previous Names
  • MO1-fncd3a
Target
Sequence
5' - GCGTTCTGAGCAATACACACCTGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fndc3a
Expressed Gene Anatomy Figures
fras1 Fig. S7 from Liedtke et al., 2019
hmcn1 Fig. S7 from Liedtke et al., 2019
hmcn2 Fig. S7 from Liedtke et al., 2019
Phenotype
Phenotype resulting from MO1-fndc3a
Phenotype Fish Figures
caudal fin deformed, abnormal WT + MO1-fndc3a Fig. S7 from Liedtke et al., 2019
caudal fin kinked, abnormal fndc3awue1/wue1 + MO1-fndc3a Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn2 expression decreased amount, abnormal WT + MO1-fndc3a Fig. S7 from Liedtke et al., 2019
ventral fin fold fras1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a Fig. S7 from Liedtke et al., 2019
ventral fin fold decreased width, abnormal fndc3awue1/wue1 + MO1-fndc3a Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn2 expression decreased amount, abnormal WT + MO1-fndc3a Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme fras1 expression decreased amount, abnormal WT + MO1-fndc3a Fig. S7 from Liedtke et al., 2019
Phenotype of all Fish created by or utilizing MO1-fndc3a
Phenotype Fish Conditions Figures
caudal fin kinked, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold fras1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn2 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme fras1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn2 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
caudal fin deformed, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold decreased width, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn2 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn1 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold fras1 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
caudal fin deformed, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme fras1 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold decreased width, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn2 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn1 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.