Morpholino

MO1-traf4a

ID

ZDB-MRPHLNO-200127-1

Name

MO1-traf4a

Previous Names

traf4a e1i1 (1)

Target

traf4a (1)

Sequence

5' - GGCCAAACGTTGCTCTTACCTGAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-traf4a

Expressed Gene	Anatomy	Figures
fgf8a	anterior neural rod midbrain hindbrain boundary neural rod	Fig. 3 from Hehr et al., 2018
pax6a	midbrain hindbrain boundary neural rod optic vesicle	Fig. 3 from Hehr et al., 2018
rx3	anterior neural rod optic stalk optic vesicle	Fig. 3 from Hehr et al., 2018
six3a	anterior neural rod	Fig. 3 from Hehr et al., 2018
vax1	anterior neural rod optic stalk	Fig. 3 from Hehr et al., 2018
vax2	optic vesicle anterior region	Fig. 3 from Hehr et al., 2018

Phenotype

Phenotype resulting from MO1-traf4a

Phenotype	Fish	Figures
eye apoptotic process increased occurrence, abnormal	traf4a^ca301/ca301 + MO1-traf4a	Fig. 6 from Hehr et al., 2018
head bilateral symmetry, abnormal	zf460Tg + MO1-traf4a	Fig. 2 , Fig. 6 from Hehr et al., 2018
optic vesicle decreased size, abnormal	zf460Tg + MO1-traf4a	Fig. 2 , Fig. 6 from Hehr et al., 2018
optic vesicle increased variability of size, abnormal	zf460Tg + MO1-traf4a	Fig. 2 , Fig. 6 from Hehr et al., 2018
optic vesicle ab1-prkcz labeling mislocalised, abnormal	zf460Tg + MO1-traf4a	Fig. 7 from Hehr et al., 2018
optic vesicle ab1-lama1 labeling mislocalised, abnormal	zf460Tg + MO1-traf4a	Fig. 7 from Hehr et al., 2018
optic vesicle apical surface ab1-prkcz labeling spatial pattern, abnormal	zf460Tg + MO1-traf4a	Fig. 7 from Hehr et al., 2018
optic vesicle apical surface ab1-tjp1 labeling spatial pattern, abnormal	zf460Tg + MO1-traf4a	Fig. 7 from Hehr et al., 2018
optic vesicle basal surface ab1-lama1 labeling spatial pattern, abnormal	zf460Tg + MO1-traf4a	Fig. 7 from Hehr et al., 2018

Phenotype of all Fish created by or utilizing MO1-traf4a

Phenotype	Fish	Conditions	Figures
head bilateral symmetry, abnormal	traf4a^ca301/ca301 + MO1-traf4a	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle decreased size, abnormal	traf4a^ca301/ca301 + MO1-traf4a	standard conditions	Fig. 6 from Hehr et al., 2018
eye apoptotic process increased occurrence, abnormal	traf4a^ca301/ca301 + MO1-traf4a	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle increased variability of size, abnormal	traf4a^ca301/ca301 + MO1-traf4a	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle apical surface ab1-prkcz labeling spatial pattern, abnormal	zf460Tg + MO1-traf4a	standard conditions	Fig. 7 from Hehr et al., 2018
optic vesicle decreased size, abnormal	zf460Tg + MO1-traf4a	standard conditions	Fig. 2 , Fig. 6 from Hehr et al., 2018
optic vesicle ab1-lama1 labeling mislocalised, abnormal	zf460Tg + MO1-traf4a	standard conditions	Fig. 7 from Hehr et al., 2018
optic vesicle increased variability of size, abnormal	zf460Tg + MO1-traf4a	standard conditions	Fig. 2 , Fig. 6 from Hehr et al., 2018
optic vesicle ab1-prkcz labeling mislocalised, abnormal	zf460Tg + MO1-traf4a	standard conditions	Fig. 7 from Hehr et al., 2018
optic vesicle basal surface ab1-lama1 labeling spatial pattern, abnormal	zf460Tg + MO1-traf4a	standard conditions	Fig. 7 from Hehr et al., 2018
head bilateral symmetry, abnormal	zf460Tg + MO1-traf4a	standard conditions	Fig. 2 , Fig. 6 from Hehr et al., 2018
optic vesicle apical surface ab1-tjp1 labeling spatial pattern, abnormal	zf460Tg + MO1-traf4a	standard conditions	Fig. 7 from Hehr et al., 2018

Citations