Morpholino

MO1-eng

ID
ZDB-MRPHLNO-191113-6
Name
MO1-eng
Previous Names
None
Target
Sequence
5' - GATGAACTCAACACTCGTGTCTGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-eng
Expressed Gene Anatomy Figures
aplnra Fig. 1 from Wang et al., 2020
bmper Figure 5 with image from Zhang et al., 2019
cdh5 Figure 4 with image,  Figure 5 with image from Zhang et al., 2019
dll4 Figure 4 with image,  Figure 5 with image from Zhang et al., 2019
flt4 Figure 4 with image,  Figure 5 with image from Zhang et al., 2019
hey2 Figure 4 with image from Zhang et al., 2019
id1 Figure 3 with image from Zhang et al., 2019
id3 Figure 3 with image from Zhang et al., 2019
jdp2b Figure 3 with image from Zhang et al., 2019
kdrl Figure 4 with image,  Figure 5 with image from Zhang et al., 2019
lmo2 Figure 4 with image from Zhang et al., 2019
nrp1a Fig. 1 from Wang et al., 2020
spi1b Figure 4 with image from Zhang et al., 2019
Phenotype
Phenotype resulting from MO1-eng
Phenotype Fish Figures
blood island bmper expression decreased distribution, abnormal WT + MO1-eng Figure 5 with image from Zhang et al., 2019
blood vessel endothelium aplnra expression decreased amount, abnormal WT + MO1-eng Fig. 1 from Wang et al., 2020
blood vessel endothelium nrp1a expression decreased amount, abnormal WT + MO1-eng Fig. 1 from Wang et al., 2020
brain kdrl expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
brain flt4 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
brain cdh5 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
dorsal aorta cdh5 expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
endothelial cell lmo2 expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
endothelial cell hey2 expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
endothelial cell kdrl expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
endothelial cell spi1b expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
intersegmental vein broken, abnormal y1Tg + MO1-eng Figure 3 with image from Zhang et al., 2019
intersegmental vein EGFP expression decreased distribution, abnormal y1Tg + MO1-eng Figure 5 with image from Zhang et al., 2019
intersegmental vein EGFP expression spatial pattern, abnormal y1Tg + MO1-eng Figure 3 with image from Zhang et al., 2019
posterior cardinal vein cdh5 expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
trunk dll4 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
trunk cdh5 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
trunk kdrl expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
trunk flt4 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
vasculature EGFP expression decreased distribution, abnormal y1Tg + MO1-eng Figure 5 with image from Zhang et al., 2019
whole organism kdrl expression decreased amount, abnormal WT + MO1-eng Figure 4 with image,  Figure 5 with image from Zhang et al., 2019
whole organism id3 expression decreased amount, abnormal WT + MO1-eng Figure 3 with image from Zhang et al., 2019
whole organism flt4 expression decreased amount, abnormal WT + MO1-eng Figure 5 with image from Zhang et al., 2019
whole organism bmper expression decreased amount, abnormal WT + MO1-eng Figure 5 with image from Zhang et al., 2019
whole organism spi1b expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
whole organism lmo2 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
whole organism id1 expression decreased amount, abnormal WT + MO1-eng Figure 3 with image from Zhang et al., 2019
whole organism jdp2b expression decreased amount, abnormal WT + MO1-eng Figure 3 with image from Zhang et al., 2019
whole organism dll4 expression decreased amount, abnormal WT + MO1-eng Figure 5 with image from Zhang et al., 2019
whole organism hey2 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
whole organism cdh5 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image,  Figure 5 with image from Zhang et al., 2019
Phenotype of all Fish created by or utilizing MO1-eng
Phenotype Fish Conditions Figures
whole organism cdh5 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image,  Figure 5 with image from Zhang et al., 2019
blood vessel endothelium nrp1a expression decreased amount, abnormal WT + MO1-eng standard conditions Fig. 1 from Wang et al., 2020
dorsal aorta blood vessel endothelial cell decreased area, abnormal WT + MO1-eng chemical treatment by environment: inhibitor Fig. 9 from Klems et al., 2020
whole organism hey2 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism spi1b expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism flt4 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
whole organism id1 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 3 with image from Zhang et al., 2019
trunk kdrl expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism kdrl expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image,  Figure 5 with image from Zhang et al., 2019
trunk dll4 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
dorsal aorta decreased diameter, abnormal WT + MO1-eng chemical treatment by environment: inhibitor Fig. 9 from Klems et al., 2020
endothelial cell hey2 expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
trunk flt4 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
dorsal aorta cdh5 expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
brain flt4 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism id3 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 3 with image from Zhang et al., 2019
whole organism dll4 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
brain cdh5 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
blood island bmper expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
endothelial cell spi1b expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
brain kdrl expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism jdp2b expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 3 with image from Zhang et al., 2019
whole organism lmo2 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism bmper expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
endothelial cell kdrl expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
trunk cdh5 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
blood vessel endothelium aplnra expression decreased amount, abnormal WT + MO1-eng standard conditions Fig. 1 from Wang et al., 2020
posterior cardinal vein cdh5 expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
endothelial cell lmo2 expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
intersegmental vein EGFP expression spatial pattern, abnormal y1Tg + MO1-eng standard conditions Figure 3 with image from Zhang et al., 2019
intersegmental vein EGFP expression decreased distribution, abnormal y1Tg + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
vasculature EGFP expression decreased distribution, abnormal y1Tg + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
intersegmental vein broken, abnormal y1Tg + MO1-eng standard conditions Figure 3 with image from Zhang et al., 2019
dorsal aorta decreased diameter, abnormal WT + MO1-eng + MO1-trioa standard conditions Fig. 9 from Klems et al., 2020
dorsal aorta blood vessel endothelial cell decreased area, abnormal WT + MO1-eng + MO1-trioa standard conditions Fig. 9 from Klems et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.