Morpholino

MO1-dnai4

ID
ZDB-MRPHLNO-191017-2
Name
MO1-dnai4
Previous Names
  • MO1-wdr78
Target
Sequence
5' - TCTGTGTGACTGTTGTGTTAGACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnai4
No data available
Phenotype
Phenotype resulting from MO1-dnai4
Phenotype Fish Figures
head hydrocephalic, abnormal WT + MO1-dnai4 Fig. 5 from Zhang et al., 2018
heart looping disrupted, abnormal WT + MO1-dnai4 Fig. 5 from Zhang et al., 2018
Kupffer's vesicle epithelial cilium movement involved in determination of left/right asymmetry asynchronous, abnormal WT + MO1-dnai4 Fig. S3 from Zhang et al., 2018
otolith decreased size, abnormal WT + MO1-dnai4 Fig. 5 from Zhang et al., 2018
otolith position, abnormal WT + MO1-dnai4 Fig. 5 from Zhang et al., 2018
pronephros cystic, abnormal WT + MO1-dnai4 Fig. 5,  Fig. S3 from Zhang et al., 2018
pronephros cilium paralysed, abnormal WT + MO1-dnai4 Fig. S3 from Zhang et al., 2018
pronephros epithelial cilium movement involved in extracellular fluid movement asynchronous, abnormal WT + MO1-dnai4 Fig. S3 from Zhang et al., 2018
spinal cord cilium movement quality, abnormal WT + MO1-dnai4 Fig. 5 from Zhang et al., 2018
spinal cord epithelial cilium movement involved in extracellular fluid movement asynchronous, abnormal WT + MO1-dnai4 Fig. 5 from Zhang et al., 2018
whole organism curved, abnormal WT + MO1-dnai4 Fig. 5 from Zhang et al., 2018
Phenotype of all Fish created by or utilizing MO1-dnai4
Phenotype Fish Conditions Figures
spinal cord cilium movement quality, abnormal WT + MO1-dnai4 standard conditions Fig. 5 from Zhang et al., 2018
otolith position, abnormal WT + MO1-dnai4 standard conditions Fig. 5 from Zhang et al., 2018
pronephros cystic, abnormal WT + MO1-dnai4 standard conditions Fig. 5,  Fig. S3 from Zhang et al., 2018
pronephros epithelial cilium movement involved in extracellular fluid movement asynchronous, abnormal WT + MO1-dnai4 standard conditions Fig. S3 from Zhang et al., 2018
whole organism curved, abnormal WT + MO1-dnai4 standard conditions Fig. 5 from Zhang et al., 2018
head hydrocephalic, abnormal WT + MO1-dnai4 standard conditions Fig. 5 from Zhang et al., 2018
otolith decreased size, abnormal WT + MO1-dnai4 standard conditions Fig. 5 from Zhang et al., 2018
pronephros cilium paralysed, abnormal WT + MO1-dnai4 standard conditions Fig. S3 from Zhang et al., 2018
heart looping disrupted, abnormal WT + MO1-dnai4 standard conditions Fig. 5 from Zhang et al., 2018
spinal cord epithelial cilium movement involved in extracellular fluid movement asynchronous, abnormal WT + MO1-dnai4 standard conditions Fig. 5 from Zhang et al., 2018
Kupffer's vesicle epithelial cilium movement involved in determination of left/right asymmetry asynchronous, abnormal WT + MO1-dnai4 standard conditions Fig. S3 from Zhang et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.