ZFIN ID: ZDB-MRPHLNO-191003-4
Morpholino Name: MO3-smchd1
Target: smchd1 (1)
Sequence:
5' - ATCACTTCCACAACCGTCACTTTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-smchd1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-smchd1 No data available
PHENOTYPE
Phenotype resulting from MO3-smchd1
No data available

Phenotype of all Fish created by or utilizing MO3-smchd1
No data available
Genome Resources:
CITATIONS (1)