Morpholino

MO2-agbl2

ID
ZDB-MRPHLNO-190904-1
Name
MO2-agbl2
Previous Names
None
Target
Sequence
5' - AAGGATCGTCTGATTTCTTCTGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-agbl2
No data available
Phenotype
Phenotype resulting from MO2-agbl2
Phenotype of all Fish created by or utilizing MO2-agbl2
Phenotype Fish Conditions Figures
whole organism pgam1a expression decreased amount, abnormal WT + MO2-agbl2 standard conditions Fig. 5 from Maimouni et al., 2019
whole organism aldocb expression decreased amount, abnormal WT + MO2-agbl2 standard conditions Fig. 5 from Maimouni et al., 2019
midbrain granular, abnormal WT + MO2-agbl2 standard conditions text only from Maimouni et al., 2019
hindbrain granular, abnormal WT + MO2-agbl2 standard conditions text only from Maimouni et al., 2019
whole organism pgk1 expression decreased amount, abnormal WT + MO2-agbl2 standard conditions Fig. 5 from Maimouni et al., 2019
whole organism cell death increased occurrence, abnormal WT + MO2-agbl2 standard conditions text only from Maimouni et al., 2019
whole organism eno1a expression decreased amount, abnormal WT + MO2-agbl2 standard conditions Fig. 5 from Maimouni et al., 2019
midbrain opaque, abnormal WT + MO2-agbl2 standard conditions text only from Maimouni et al., 2019
hindbrain opaque, abnormal WT + MO2-agbl2 standard conditions text only from Maimouni et al., 2019
whole organism apoptotic process increased occurrence, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
whole organism decreased size, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
midbrain granular, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
hindbrain opaque, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
whole organism cell death increased occurrence, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
whole organism morphology, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
midbrain opaque, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
hindbrain granular, abnormal WT + MO2-agbl2 + MO4-tp53 standard conditions Fig. 2 with image from Maimouni et al., 2019
Citations