Morpholino

MO1-npl

ID
ZDB-MRPHLNO-190828-2
Name
MO1-npl
Previous Names
  • npl-atg (1)
Target
Sequence
5' - CGCGTTGAGACATTTCTTCCTTTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-npl
No data available
Phenotype
Phenotype resulting from MO1-npl
Phenotype of all Fish created by or utilizing MO1-npl
Phenotype Fish Conditions Figures
muscle disorganized, abnormal WT + MO1-npl control Fig. 8 from Wen et al., 2018
skeletal muscle reactive oxygen species increased amount, abnormal WT + MO1-npl standard conditions Fig. 5 from Wen et al., 2018
skeletal muscle reactive oxygen species amount, ameliorated WT + MO1-npl chemical treatment by environment: N-acetylmannosamine Fig. 5 from Wen et al., 2018
muscle cell organized, ameliorated WT + MO1-npl chemical treatment by environment: N-acetyl-D-glucosamine Fig. 9 from Wen et al., 2018
pericardium edematous, abnormal WT + MO1-npl standard conditions Fig. 4 from Wen et al., 2018
somite disorganized, abnormal WT + MO1-npl standard conditions Fig. 4 from Wen et al., 2018
locomotory behavior decreased process quality, abnormal WT + MO1-npl standard conditions Fig. 5 from Wen et al., 2018
muscle cell organized, ameliorated WT + MO1-npl chemical treatment by environment: sialic acid Fig. 9 from Wen et al., 2018
muscle disorganized, abnormal WT + MO1-npl chemical treatment by environment: D-galactose Fig. 8 from Wen et al., 2018
muscle organized, ameliorated WT + MO1-npl chemical treatment by environment: N-acetylmannosamine Fig. 8 from Wen et al., 2018
head muscle absent, abnormal WT + MO1-npl standard conditions Fig. S4 from Wen et al., 2018
caudal fin curved, abnormal WT + MO1-npl standard conditions Fig. 4 from Wen et al., 2018
extraocular musculature absent, abnormal WT + MO1-npl standard conditions Fig. S4 from Wen et al., 2018
locomotory behavior process quality, ameliorated WT + MO1-npl chemical treatment by environment: N-acetylmannosamine Fig. 5 from Wen et al., 2018
muscle disorganized, abnormal WT + MO1-npl chemical treatment by environment: D-mannose Fig. 8 from Wen et al., 2018
muscle cell disorganized, abnormal WT + MO1-npl standard conditions Fig. 4Fig. 9 from Wen et al., 2018
muscle organized, ameliorated WT + MO1-npl chemical treatment by environment: sialic acid Fig. 8 from Wen et al., 2018
muscle organized, ameliorated WT + MO1-npl chemical treatment by environment: N-acetyl-D-glucosamine Fig. 8 from Wen et al., 2018
muscle disorganized, abnormal WT + MO1-npl chemical treatment by environment: D-xylose Fig. 8 from Wen et al., 2018
muscle cell organized, ameliorated WT + MO1-npl chemical treatment by environment: N-acetylmannosamine Fig. 9 from Wen et al., 2018
skeletal muscle morphology, abnormal WT + MO1-npl standard conditions Fig. S4 from Wen et al., 2018
heart looping decreased occurrence, abnormal twu34Tg + MO1-npl chemical treatment by environment: sialic acid Fig. 9 from Wen et al., 2018
heart looping occurrence, ameliorated twu34Tg + MO1-npl chemical treatment by environment: N-acetylmannosamine Fig. 9 from Wen et al., 2018
heart looping decreased occurrence, abnormal twu34Tg + MO1-npl standard conditions Fig. 4Fig. 9 from Wen et al., 2018
heart looping decreased occurrence, abnormal twu34Tg + MO1-npl chemical treatment by environment: N-acetyl-D-glucosamine Fig. 9 from Wen et al., 2018
Citations