Morpholino
MO2-nid1a
- ID
- ZDB-MRPHLNO-190813-3
- Name
- MO2-nid1a
- Previous Names
- None
- Target
- Sequence
-
5' - GTGCCGACCCATATCCAGTCCCAAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nid1a
No data available
Phenotype
Phenotype resulting from MO2-nid1a
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO2-nid1a
1 - 5 of 15 Show all
Citations
- Soans, K.G., Ramos, A.P., Sidhaye, J., Krishna, A., Solomatina, A., Hoffmann, K.B., Schlüßler, R., Guck, J., Sbalzarini, I.F., Modes, C.D., Norden, C. (2022) Collective cell migration during optic cup formation features changing cell-matrix interactions linked to matrix topology. Current biology : CB. 32(22):4817-4831.e9
- Ma, Z., Zhu, P., Shi, H., Guo, L., Zhang, Q., Chen, Y., Chen, S., Zhang, Z., Peng, J., Chen, J. (2019) PTC-bearing mRNA elicits a genetic compensation response via Upf3a and COMPASS components. Nature. 568(7751):259-263
- Nicholas, C., Weaver, M., Piedade, W.P., Vocking, O., Famulski, J.K. (2019) Temporal characterization of optic fissure basement membrane composition suggests nidogen may be an initial target of remodeling. Developmental Biology. 452(1):43-54
1 - 3 of 3
Show