Morpholino

MO4-sars1

ID

ZDB-MRPHLNO-181218-1

Name

MO4-sars1

Previous Names

Target

Sequence

5' - GTCTAAATCGAGCACCATTATGCCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-sars1

No data available

Phenotype

Phenotype resulting from MO4-sars1

Phenotype	Fish	Figures
basal communicating artery deformed, abnormal	pku6Tg + MO4-sars1	Fig. 2 from Wang et al., 2018
basal communicating artery dilated, abnormal	pku6Tg + MO4-sars1	Fig. 2 from Wang et al., 2018
basal communicating artery fused with primordial midbrain channel, abnormal	pku6Tg + MO4-sars1	Fig. 2 from Wang et al., 2018
basilar artery fused with primordial hindbrain channel, abnormal	pku6Tg + MO4-sars1	Fig. 2 from Wang et al., 2018
cranial division of the internal carotid artery dysplastic, abnormal	pku6Tg + MO4-sars1	Fig. 2 from Wang et al., 2018
cranium edematous, abnormal	pku6Tg + MO4-sars1	Fig. S1 from Wang et al., 2018
pericardium edematous, abnormal	pku6Tg + MO4-sars1	Fig. S1 from Wang et al., 2018
posterior communicating artery deformed, abnormal	pku6Tg + MO4-sars1	Fig. 2 from Wang et al., 2018
posterior communicating artery dilated, abnormal	pku6Tg + MO4-sars1	Fig. 2 from Wang et al., 2018

Phenotype of all Fish created by or utilizing MO4-sars1

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	pku6Tg + MO4-sars1	standard conditions	Fig. S1 from Wang et al., 2018
basal communicating artery fused with primordial midbrain channel, abnormal	pku6Tg + MO4-sars1	standard conditions	Fig. 2 from Wang et al., 2018
cranial division of the internal carotid artery dysplastic, abnormal	pku6Tg + MO4-sars1	standard conditions	Fig. 2 from Wang et al., 2018
basilar artery fused with primordial hindbrain channel, abnormal	pku6Tg + MO4-sars1	standard conditions	Fig. 2 from Wang et al., 2018
posterior communicating artery deformed, abnormal	pku6Tg + MO4-sars1	standard conditions	Fig. 2 from Wang et al., 2018
basal communicating artery dilated, abnormal	pku6Tg + MO4-sars1	standard conditions	Fig. 2 from Wang et al., 2018
basal communicating artery deformed, abnormal	pku6Tg + MO4-sars1	standard conditions	Fig. 2 from Wang et al., 2018
posterior communicating artery dilated, abnormal	pku6Tg + MO4-sars1	standard conditions	Fig. 2 from Wang et al., 2018
cranium edematous, abnormal	pku6Tg + MO4-sars1	standard conditions	Fig. S1 from Wang et al., 2018

Citations