Morpholino

MO1-washc4

ID
ZDB-MRPHLNO-181217-2
Name
MO1-washc4
Previous Names
None
Target
Sequence
5' - CAGGAGATAATGAATCCACAGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-washc4
Expressed Gene Anatomy Figures
atf4a Fig. 7 with image from Kustermann et al., 2018
hspa5 Fig. 7 with image from Kustermann et al., 2018
ppp1r15a Fig. 7 with image from Kustermann et al., 2018
washc4 Fig. 5 with image from Kustermann et al., 2018
Phenotype
Phenotype resulting from MO1-washc4
Phenotype Fish Figures
autophagy decreased occurrence, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
blood circulation decreased magnitude, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
heart edematous, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
heart contraction decreased frequency, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
involuntary skeletal muscle contraction decreased occurrence, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
myotome skeletal muscle cell has extra parts of type skeletal muscle cell vesicle, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
skeletal muscle mitochondrion malformed, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
skeletal muscle sarcomere disorganized, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
skeletal muscle sarcomere organization decreased process quality, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
skeletal muscle cell has fewer parts of type skeletal muscle cell skeletal muscle myofibril, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
skeletal muscle fiber development decreased process quality, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
thigmotaxis decreased occurrence, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
whole organism washc4 expression decreased amount, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
whole organism ab1-map1lc3 labeling increased amount, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
whole organism atf4a expression increased amount, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
whole organism Ab7-sqstm1 labeling increased amount, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
whole organism hspa5 expression increased amount, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
whole organism ppp1r15a expression increased amount, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
Phenotype of all Fish created by or utilizing MO1-washc4
Phenotype Fish Conditions Figures
blood circulation decreased magnitude, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
skeletal muscle sarcomere disorganized, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
whole organism ab1-map1lc3 labeling increased amount, abnormal WT + MO1-washc4 control Fig. 7 with image from Kustermann et al., 2018
skeletal muscle sarcomere organization decreased process quality, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
thigmotaxis decreased occurrence, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
whole organism Ab7-sqstm1 labeling increased amount, abnormal WT + MO1-washc4 standard conditions Fig. 7 with image from Kustermann et al., 2018
heart contraction decreased frequency, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
myotome skeletal muscle cell has extra parts of type skeletal muscle cell vesicle, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
involuntary skeletal muscle contraction decreased occurrence, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
skeletal muscle fiber development decreased process quality, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
autophagy decreased occurrence, abnormal WT + MO1-washc4 control Fig. 7 with image from Kustermann et al., 2018
whole organism atf4a expression increased amount, abnormal WT + MO1-washc4 standard conditions Fig. 7 with image from Kustermann et al., 2018
autophagy decreased occurrence, abnormal WT + MO1-washc4 chemical treatment by environment: ammonium chloride Fig. 7 with image from Kustermann et al., 2018
skeletal muscle mitochondrion malformed, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
whole organism ab1-map1lc3 labeling increased amount, abnormal WT + MO1-washc4 chemical treatment by environment: ammonium chloride Fig. 7 with image from Kustermann et al., 2018
heart edematous, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
whole organism washc4 expression decreased amount, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
skeletal muscle cell has fewer parts of type skeletal muscle cell skeletal muscle myofibril, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
whole organism hspa5 expression increased amount, abnormal WT + MO1-washc4 standard conditions Fig. 7 with image from Kustermann et al., 2018
whole organism ppp1r15a expression increased amount, abnormal WT + MO1-washc4 standard conditions Fig. 7 with image from Kustermann et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.