Morpholino

MO1-ube2d2

ID
ZDB-MRPHLNO-181009-2
Name
MO1-ube2d2
Previous Names
None
Target
Sequence
5' - CCGTGACTTCCTTCTCTTACCTTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ube2d2
Expressed Gene Anatomy Figures
foxa Fig. 4,  Fig. EV5 from Pan et al., 2017
gli1 Fig. 4 from Pan et al., 2017
hhip Fig. 4,  Fig. EV5 from Pan et al., 2017
nkx2.2b Fig. 4 from Pan et al., 2017
ptch2 Fig. 4 from Pan et al., 2017
Phenotype
Phenotype resulting from MO1-ube2d2
Phenotype Fish Figures
central nervous system nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
central nervous system gli1 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
central nervous system ptch2 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
central nervous system hhip expression increased amount, abnormal AB + MO1-ube2d2 Fig. EV5 from Pan et al., 2017
central nervous system foxa expression increased amount, abnormal AB + MO1-ube2d2 Fig. EV5 from Pan et al., 2017
segmental plate ptch2 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
somite hhip expression increased amount, abnormal AB + MO1-ube2d2 Fig. EV5 from Pan et al., 2017
somite foxa expression increased amount, abnormal AB + MO1-ube2d2 Fig. EV5 from Pan et al., 2017
somite nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
somite ptch2 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
somite gli1 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
somite muscle pioneer increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
whole organism gli1 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
whole organism nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
whole organism hhip expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
whole organism ptch2 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
whole organism foxa expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
Phenotype of all Fish created by or utilizing MO1-ube2d2
Phenotype Fish Conditions Figures
somite ptch2 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
central nervous system hhip expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. EV5 from Pan et al., 2017
somite hhip expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. EV5 from Pan et al., 2017
central nervous system nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
whole organism nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
whole organism ptch2 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
central nervous system gli1 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
somite nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
whole organism hhip expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
central nervous system ptch2 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
segmental plate ptch2 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
somite foxa expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. EV5 from Pan et al., 2017
whole organism foxa expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
whole organism gli1 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
somite gli1 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
somite muscle pioneer increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
central nervous system foxa expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. EV5 from Pan et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.