Morpholino

MO1-ube2d2

ID
ZDB-MRPHLNO-181009-2
Name
MO1-ube2d2
Previous Names
None
Target
Sequence
5' - CCGTGACTTCCTTCTCTTACCTTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ube2d2
No data available
Phenotype
Phenotype resulting from MO1-ube2d2
Phenotype Fish Figures
central nervous system nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
central nervous system gli1 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
central nervous system ptch2 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
central nervous system foxa expression increased amount, abnormal AB + MO1-ube2d2 Fig. EV5 from Pan et al., 2017
central nervous system hhip expression increased amount, abnormal AB + MO1-ube2d2 Fig. EV5 from Pan et al., 2017
segmental plate ptch2 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
somite hhip expression increased amount, abnormal AB + MO1-ube2d2 Fig. EV5 from Pan et al., 2017
somite foxa expression increased amount, abnormal AB + MO1-ube2d2 Fig. EV5 from Pan et al., 2017
somite nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
somite ptch2 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
somite gli1 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
somite muscle pioneer increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
whole organism gli1 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
whole organism nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
whole organism hhip expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
whole organism ptch2 expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
whole organism foxa expression increased amount, abnormal AB + MO1-ube2d2 Fig. 4 from Pan et al., 2017
Phenotype of all Fish created by or utilizing MO1-ube2d2
Phenotype Fish Conditions Figures
somite ptch2 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
central nervous system hhip expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. EV5 from Pan et al., 2017
somite hhip expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. EV5 from Pan et al., 2017
central nervous system nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
whole organism nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
whole organism ptch2 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
central nervous system gli1 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
somite nkx2.2b expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
whole organism hhip expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
central nervous system ptch2 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
segmental plate ptch2 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
somite foxa expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. EV5 from Pan et al., 2017
whole organism foxa expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
whole organism gli1 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
somite gli1 expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
somite muscle pioneer increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. 4 from Pan et al., 2017
central nervous system foxa expression increased amount, abnormal AB + MO1-ube2d2 standard conditions Fig. EV5 from Pan et al., 2017
Citations