Morpholino
MO2-kita
- ID
- ZDB-MRPHLNO-180920-3
- Name
- MO2-kita
- Previous Names
- None
- Target
- Sequence
-
5' - AAAGTTTTCACTTACTGATGACATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-kita
No data available
Phenotype
Phenotype resulting from MO2-kita
| Phenotype | Fish | Figures |
|---|---|---|
| ball melanocyte decreased amount, abnormal | AB + MO2-kita |
Fig. S1 |
Phenotype of all Fish created by or utilizing MO2-kita
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| ball melanocyte decreased amount, abnormal | AB + MO2-kita | standard conditions |
Fig. S1 |
Citations