Morpholino

MO2-adamts16

ID

ZDB-MRPHLNO-180831-2

Name

MO2-adamts16

Previous Names

adamts16 e2i2 (1)

Target

adamts16 (1)

Sequence

5' - GCTGTCAATCATCTCTCACCTGTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-adamts16

No data available

Phenotype

Phenotype resulting from MO2-adamts16

Phenotype	Fish	Figures
basement membrane disassembly disrupted, abnormal	AB + MO2-adamts16	Fig. 3 from Cao et al., 2018
closure of optic fissure disrupted, abnormal	AB + MO2-adamts16	Fig. 2 from Cao et al., 2018
eye decreased area, abnormal	AB + MO2-adamts16	Fig. 2 from Cao et al., 2018
eye decreased size, abnormal	AB + MO2-adamts16	Fig. 2 from Cao et al., 2018
optic cup apoptotic process increased occurrence, abnormal	AB + MO2-adamts16	Fig. 4 from Cao et al., 2018
optic cup basement membrane morphology, abnormal	AB + MO2-adamts16	Fig. 3 from Cao et al., 2018
optic cup cell population proliferation decreased rate, abnormal	AB + MO2-adamts16	Fig. 4 from Cao et al., 2018
pericardium edematous, abnormal	AB + MO2-adamts16	Fig. S1 from Lin et al., 2023
retina perforate, abnormal	AB + MO2-adamts16	Fig. 2 from Cao et al., 2018
ventriculo bulbo valve decreased amount, abnormal	AB + MO2-adamts16	Fig. 1 , Fig. S1 from Lin et al., 2023
ventriculo bulbo valve increased thickness, abnormal	y7Tg + MO2-adamts16 (AB)	Fig. 1 , Fig. S1 from Lin et al., 2023
ventriculo bulbo valve malformed, abnormal	y7Tg + MO2-adamts16 (AB)	Fig. 1 from Lin et al., 2023

Phenotype of all Fish created by or utilizing MO2-adamts16

Phenotype	Fish	Conditions	Figures
retina perforate, abnormal	AB + MO2-adamts16	standard conditions	Fig. 2 from Cao et al., 2018
pericardium edematous, abnormal	AB + MO2-adamts16	standard conditions	Fig. S1 from Lin et al., 2023
ventriculo bulbo valve increased thickness, abnormal	AB + MO2-adamts16	standard conditions	Fig. S1 from Lin et al., 2023
basement membrane disassembly disrupted, abnormal	AB + MO2-adamts16	standard conditions	Fig. 3 from Cao et al., 2018
ventriculo bulbo valve decreased amount, abnormal	AB + MO2-adamts16	standard conditions	Fig. S1 from Lin et al., 2023
optic cup cell population proliferation decreased rate, abnormal	AB + MO2-adamts16	standard conditions	Fig. 4 from Cao et al., 2018
closure of optic fissure disrupted, abnormal	AB + MO2-adamts16	standard conditions	Fig. 2 from Cao et al., 2018
optic cup apoptotic process increased occurrence, abnormal	AB + MO2-adamts16	standard conditions	Fig. 4 from Cao et al., 2018
eye decreased size, abnormal	AB + MO2-adamts16	standard conditions	Fig. 2 from Cao et al., 2018
optic cup basement membrane morphology, abnormal	AB + MO2-adamts16	standard conditions	Fig. 3 from Cao et al., 2018
eye decreased area, abnormal	AB + MO2-adamts16	standard conditions	Fig. 2 from Cao et al., 2018
ventriculo bulbo valve increased thickness, abnormal	y7Tg + MO2-adamts16 (AB)	standard conditions	Fig. 1 from Lin et al., 2023
ventriculo bulbo valve malformed, abnormal	y7Tg + MO2-adamts16 (AB)	standard conditions	Fig. 1 from Lin et al., 2023
ventriculo bulbo valve decreased amount, abnormal	y7Tg + MO2-adamts16 (AB)	standard conditions	Fig. 1 from Lin et al., 2023
closure of optic fissure process quality, ameliorated	AB + MO2-adamts16 + MO3-fgf8a	standard conditions	Fig. 5 from Cao et al., 2018

Citations