Morpholino

MO2-sel1l

ID

ZDB-MRPHLNO-180814-2

Name

MO2-sel1l

Previous Names

None

Target

sel1l (1)

Sequence

5' - TATAATATGTGGGATTACCTGAGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-sel1l

No data available

Phenotype

Phenotype resulting from MO2-sel1l

Phenotype	Fish	Figures
blood accumulation trunk, abnormal	s843Tg; sd2Tg + MO2-sel1l	Fig. 5 from Barbieri et al., 2017
blood accumulation post-vent region, abnormal	s843Tg; sd2Tg + MO2-sel1l	Fig. 4, Fig. 5, Table 2 from Barbieri et al., 2017
blood circulation disrupted, abnormal	AB + MO2-sel1l	Fig. 4, Fig. 5 from Barbieri et al., 2017
brain edematous, abnormal	AB + MO2-sel1l	Fig. 4, Table 2 from Barbieri et al., 2017
caudal vein plexus morphology, abnormal	s843Tg; sd2Tg + MO2-sel1l	Fig. 5 from Barbieri et al., 2017
intersegmental vessel shape, abnormal	s843Tg; sd2Tg + MO2-sel1l	Fig. 5 from Barbieri et al., 2017
intersegmental vessel truncated, abnormal	s843Tg; sd2Tg + MO2-sel1l	Fig. 5 from Barbieri et al., 2017
pericardium edematous, abnormal	AB + MO2-sel1l	Fig. 4, Table 2 from Barbieri et al., 2017
post-vent vasculature hemorrhagic, abnormal	s843Tg; sd2Tg + MO2-sel1l	Fig. 5 from Barbieri et al., 2017
trunk vasculature hemorrhagic, abnormal	s843Tg; sd2Tg + MO2-sel1l	Fig. 5 from Barbieri et al., 2017
whole organism morphology, abnormal	AB + MO2-sel1l	Fig. 4 from Barbieri et al., 2017

Phenotype of all Fish created by or utilizing MO2-sel1l

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	AB + MO2-sel1l	standard conditions	Fig. 4, Table 2 from Barbieri et al., 2017
whole organism morphology, abnormal	AB + MO2-sel1l	standard conditions	Fig. 4 from Barbieri et al., 2017
blood circulation disrupted, abnormal	AB + MO2-sel1l	standard conditions	Fig. 4 from Barbieri et al., 2017
blood accumulation post-vent region, abnormal	AB + MO2-sel1l	standard conditions	Fig. 4, Table 2 from Barbieri et al., 2017
brain edematous, abnormal	AB + MO2-sel1l	standard conditions	Fig. 4, Table 2 from Barbieri et al., 2017
post-vent vasculature hemorrhagic, abnormal	s843Tg; sd2Tg + MO2-sel1l	standard conditions	Fig. 5 from Barbieri et al., 2017
trunk vasculature hemorrhagic, abnormal	s843Tg; sd2Tg + MO2-sel1l	standard conditions	Fig. 5 from Barbieri et al., 2017
caudal vein plexus morphology, abnormal	s843Tg; sd2Tg + MO2-sel1l	standard conditions	Fig. 5 from Barbieri et al., 2017
intersegmental vessel truncated, abnormal	s843Tg; sd2Tg + MO2-sel1l	standard conditions	Fig. 5 from Barbieri et al., 2017
blood accumulation trunk, abnormal	s843Tg; sd2Tg + MO2-sel1l	standard conditions	Fig. 5 from Barbieri et al., 2017
blood circulation disrupted, abnormal	s843Tg; sd2Tg + MO2-sel1l	standard conditions	Fig. 5 from Barbieri et al., 2017
intersegmental vessel shape, abnormal	s843Tg; sd2Tg + MO2-sel1l	standard conditions	Fig. 5 from Barbieri et al., 2017
blood accumulation post-vent region, abnormal	s843Tg; sd2Tg + MO2-sel1l	standard conditions	Fig. 5 from Barbieri et al., 2017

Citations