Morpholino
MO2-eif2ak3
- ID
- ZDB-MRPHLNO-180802-2
- Name
- MO2-eif2ak3
- Previous Names
- None
- Target
- Sequence
-
5' - AACAACTGTGTGGAATACCTTGCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-eif2ak3
No data available
Phenotype
Phenotype resulting from MO2-eif2ak3
No data available
Phenotype of all Fish created by or utilizing MO2-eif2ak3
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| gill gstp1.2 expression increased amount, abnormal | AB + MO2-eif2ak3 | chemical treatment: diethyl maleate |
Fig. S6 |
Citations