Morpholino

MO2-kat7b

ID
ZDB-MRPHLNO-180731-1
Name
MO2-kat7b
Previous Names
None
Target
Sequence
5' - CATGTTCCCTCCGATAAATCCAATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-kat7b
Expressed Gene Anatomy Figures
flt1 Fig. 14 from Yan et al., 2018
kat7b Fig. 11 from Yan et al., 2018
kdr Fig. 14 from Yan et al., 2018
kdrl Fig. 14 from Yan et al., 2018
Phenotype
Phenotype resulting from MO2-kat7b
Phenotype Fish Figures
blood accumulation yolk, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12,  Fig. 15 from Yan et al., 2018
blood accumulation trunk, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12,  Fig. 15 from Yan et al., 2018
brain hemorrhagic, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12,  Fig. 15 from Yan et al., 2018
caudal vein blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12,  Fig. 15 from Yan et al., 2018
dorsal aorta blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12,  Fig. 15 from Yan et al., 2018
endothelial cell flt1 expression decreased amount, abnormal s843Tg + MO2-kat7b Fig. 14 from Yan et al., 2018
endothelial cell kdrl expression decreased amount, abnormal s843Tg + MO2-kat7b Fig. 14 from Yan et al., 2018
intersegmental vessel blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12,  Fig. 15 from Yan et al., 2018
intersegmental vessel endothelial cell decreased amount, abnormal y7Tg + MO2-kat7b Fig. 11,  Fig. 13 from Yan et al., 2018
subintestinal vein malformed, abnormal s843Tg; sd2Tg + MO2-kat7b Fig. 12,  Fig. 15 from Yan et al., 2018
whole organism kdrl expression decreased amount, abnormal s843Tg + MO2-kat7b Fig. 14 from Yan et al., 2018
whole organism kdr expression decreased amount, abnormal s843Tg + MO2-kat7b Fig. 14 from Yan et al., 2018
whole organism kat7b expression decreased amount, abnormal y7Tg + MO2-kat7b Fig. 11 from Yan et al., 2018
whole organism flt1 expression decreased amount, abnormal s843Tg + MO2-kat7b Fig. 14 from Yan et al., 2018
Phenotype of all Fish created by or utilizing MO2-kat7b
Phenotype Fish Conditions Figures
whole organism kdrl expression decreased amount, abnormal s843Tg + MO2-kat7b standard conditions Fig. 14 from Yan et al., 2018
endothelial cell flt1 expression decreased amount, abnormal s843Tg + MO2-kat7b standard conditions Fig. 14 from Yan et al., 2018
endothelial cell kdrl expression decreased amount, abnormal s843Tg + MO2-kat7b standard conditions Fig. 14 from Yan et al., 2018
whole organism flt1 expression decreased amount, abnormal s843Tg + MO2-kat7b standard conditions Fig. 14 from Yan et al., 2018
whole organism kdr expression decreased amount, abnormal s843Tg + MO2-kat7b standard conditions Fig. 14 from Yan et al., 2018
whole organism kat7b expression decreased amount, abnormal y7Tg + MO2-kat7b standard conditions Fig. 11 from Yan et al., 2018
intersegmental vessel endothelial cell decreased amount, abnormal y7Tg + MO2-kat7b standard conditions Fig. 11,  Fig. 13 from Yan et al., 2018
subintestinal vein malformed, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12,  Fig. 15 from Yan et al., 2018
blood accumulation yolk, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12,  Fig. 15 from Yan et al., 2018
blood accumulation trunk, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12,  Fig. 15 from Yan et al., 2018
dorsal aorta blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12,  Fig. 15 from Yan et al., 2018
caudal vein blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12,  Fig. 15 from Yan et al., 2018
brain hemorrhagic, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12,  Fig. 15 from Yan et al., 2018
intersegmental vessel blood circulation decreased efficacy, abnormal s843Tg; sd2Tg + MO2-kat7b standard conditions Fig. 12,  Fig. 15 from Yan et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.