Morpholino

MO2-irs1

ID
ZDB-MRPHLNO-180717-1
Name
MO2-irs1
Previous Names
None
Target
Sequence
5' - ACAGAAAAATTGCAGGATCGGAAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-irs1
No data available
Phenotype
Phenotype resulting from MO2-irs1
Phenotype of all Fish created by or utilizing MO2-irs1
Phenotype Fish Conditions Figures
neural crest ab5-akt labeling decreased amount, abnormal WT + MO2-irs1 hypoxia Fig. 5 from Kamei et al., 2018
whole organism ab7-mapk labeling decreased amount, abnormal WT + MO2-irs1 control Fig. 4 from Kamei et al., 2018
pharyngeal arch mesenchyme derived from head neural crest dlx2a expression decreased amount, abnormal WT + MO2-irs1 hypoxia Fig. 5 from Kamei et al., 2018
whole organism pdgfrb expression decreased amount, abnormal WT + MO2-irs1 hypoxia Fig. 5 from Kamei et al., 2018
neural crest ab5-akt labeling decreased amount, abnormal WT + MO2-irs1 control Fig. 5 from Kamei et al., 2018
neural crest cell death increased occurrence, abnormal WT + MO2-irs1 hypoxia Fig. 5 from Kamei et al., 2018
whole organism anterior region ab1-casp3 labeling increased amount, abnormal WT + MO2-irs1 hypoxia Fig. 5 from Kamei et al., 2018
developmental growth decreased rate, abnormal WT + MO2-irs1 hypoxia Fig. 3 from Kamei et al., 2018
neural crest ab1-casp3 labeling increased amount, abnormal WT + MO2-irs1 hypoxia Fig. 5 from Kamei et al., 2018
cell death occurrence, ameliorated WT + MO2-irs1 hypoxia, chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 from Kamei et al., 2018
whole organism ngfra expression decreased amount, abnormal WT + MO2-irs1 hypoxia Fig. 5 from Kamei et al., 2018
whole organism ab2-akt labeling decreased amount, abnormal WT + MO2-irs1 control Fig. 4 from Kamei et al., 2018
developmental growth decreased rate, abnormal WT + MO2-irs1 control Fig. 3 from Kamei et al., 2018
whole organism ab7-mapk labeling decreased amount, abnormal WT + MO2-irs1 hypoxia Fig. 4 from Kamei et al., 2018
whole organism ab2-akt labeling decreased amount, abnormal WT + MO2-irs1 hypoxia Fig. 4 from Kamei et al., 2018
brain dlx2a expression decreased amount, abnormal WT + MO2-irs1 hypoxia Fig. 5 from Kamei et al., 2018
cell death increased occurrence, abnormal WT + MO2-irs1 hypoxia Fig. 6 from Kamei et al., 2018
developmental growth decreased rate, abnormal WT + MO2-irs1 oxygen content, hypoxia Fig. 3 from Kamei et al., 2018
Citations