Morpholino

MO2-wdr11

ID
ZDB-MRPHLNO-180628-2
Name
MO2-wdr11
Previous Names
  • exon 9–intron 9 (1)
Target
Sequence
5' - TGGGTGGACGGCTATCTTACCAATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wdr11
No data available
Phenotype
Phenotype resulting from MO2-wdr11
Phenotype Fish Figures
ceratobranchial cartilage mislocalised, abnormal AB/TL + MO2-wdr11 Fig. S5 from Kim et al., 2017
ceratohyal cartilage mislocalised, abnormal AB/TL + MO2-wdr11 Fig. S5 from Kim et al., 2017
cranial skeletal system development process quality, abnormal AB/TL + MO2-wdr11 Fig. S5 from Kim et al., 2017
cranium decreased size, abnormal AB/TL + MO2-wdr11 Fig. 4 with imageFig. S5 from Kim et al., 2017
eye decreased size, abnormal AB/TL + MO2-wdr11 Fig. 4 with image from Kim et al., 2017
head ptch2 expression decreased amount, abnormal AB/TL + MO2-wdr11 Fig. 4 with image from Kim et al., 2017
head cartilage development disrupted, abnormal AB/TL + MO2-wdr11 Fig. S5 from Kim et al., 2017
Meckel's cartilage decreased size, abnormal AB/TL + MO2-wdr11 Fig. S5 from Kim et al., 2017
melanocyte migration disrupted, abnormal AB/TL + MO2-wdr11 Fig. 4 with image from Kim et al., 2017
myotome ptch2 expression decreased amount, abnormal AB/TL + MO2-wdr11 Fig. 4 with image from Kim et al., 2017
myotome development disrupted, abnormal AB/TL + MO2-wdr11 Fig. 4 with image from Kim et al., 2017
neural crest cell migration disrupted, abnormal AB/TL + MO2-wdr11 Fig. S5 from Kim et al., 2017
olfactory pit motile cilium absent, abnormal AB/TL + MO2-wdr11 Fig. 4 with image from Kim et al., 2017
olfactory pit motile cilium decreased amount, abnormal AB/TL + MO2-wdr11 Fig. 4 with image from Kim et al., 2017
palatoquadrate cartilage decreased size, abnormal AB/TL + MO2-wdr11 Fig. S5 from Kim et al., 2017
skeletal muscle refractivity, abnormal AB/TL + MO2-wdr11 Fig. 4 with image from Kim et al., 2017
Phenotype of all Fish created by or utilizing MO2-wdr11
Phenotype Fish Conditions Figures
myotome development disrupted, abnormal AB/TL + MO2-wdr11 standard conditions Fig. 4 with image from Kim et al., 2017
eye decreased size, abnormal AB/TL + MO2-wdr11 standard conditions Fig. 4 with image from Kim et al., 2017
cranium decreased size, abnormal AB/TL + MO2-wdr11 standard conditions Fig. 4 with imageFig. S5 from Kim et al., 2017
melanocyte migration disrupted, abnormal AB/TL + MO2-wdr11 standard conditions Fig. 4 with image from Kim et al., 2017
palatoquadrate cartilage decreased size, abnormal AB/TL + MO2-wdr11 standard conditions Fig. S5 from Kim et al., 2017
ceratohyal cartilage mislocalised, abnormal AB/TL + MO2-wdr11 standard conditions Fig. S5 from Kim et al., 2017
head cartilage development disrupted, abnormal AB/TL + MO2-wdr11 standard conditions Fig. S5 from Kim et al., 2017
cranial skeletal system development process quality, abnormal AB/TL + MO2-wdr11 standard conditions Fig. S5 from Kim et al., 2017
olfactory pit motile cilium absent, abnormal AB/TL + MO2-wdr11 standard conditions Fig. 4 with image from Kim et al., 2017
myotome ptch2 expression decreased amount, abnormal AB/TL + MO2-wdr11 standard conditions Fig. 4 with image from Kim et al., 2017
neural crest cell migration disrupted, abnormal AB/TL + MO2-wdr11 standard conditions Fig. S5 from Kim et al., 2017
head ptch2 expression decreased amount, abnormal AB/TL + MO2-wdr11 standard conditions Fig. 4 with image from Kim et al., 2017
Meckel's cartilage decreased size, abnormal AB/TL + MO2-wdr11 standard conditions Fig. S5 from Kim et al., 2017
ceratobranchial cartilage mislocalised, abnormal AB/TL + MO2-wdr11 standard conditions Fig. S5 from Kim et al., 2017
olfactory pit motile cilium decreased amount, abnormal AB/TL + MO2-wdr11 standard conditions Fig. 4 with image from Kim et al., 2017
skeletal muscle refractivity, abnormal AB/TL + MO2-wdr11 standard conditions Fig. 4 with image from Kim et al., 2017
Citations