Morpholino

MO1-h2az2b

ID
ZDB-MRPHLNO-180507-2
Name
MO1-h2az2b
Previous Names
  • MO1-h2afvb
Target
Sequence
5' - CTTTTCCTGCTTTGCCTCCTGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-h2az2b
No data available
Phenotype
Phenotype resulting from MO1-h2az2b
Phenotype of all Fish created by or utilizing MO1-h2az2b
Phenotype Fish Conditions Figures
somite decreased amount, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
whole organism 5-methylcytosine increased amount, abnormal WT + MO1-h2az2b standard conditions Fig. 5 with image from Madakashira et al., 2017
macromolecule methylation increased occurrence, abnormal WT + MO1-h2az2b standard conditions Fig. 3Fig. 5 with image from Madakashira et al., 2017
caudal fin absent, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
whole organism decreased length, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
whole organism Ab1-h2afva labeling decreased amount, abnormal WT + MO1-h2az2b standard conditions Fig. 1 with imageFig. 5 with image from Madakashira et al., 2017
midbrain hindbrain boundary absent, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
eye absent, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
hindbrain decreased height, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
head necrotic, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
whole organism decreased life span, abnormal WT + MO1-h2az2b standard conditions Fig. 1 with imageFig. 5 with image from Madakashira et al., 2017
whole organism morphology, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with imageFig. 5 with image from Madakashira et al., 2017
whole organism 5-methylcytosine increased amount, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism Ab1-h2afva labeling decreased amount, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism morphology, ameliorated WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism decreased life span, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
macromolecule methylation increased occurrence, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
Citations