Morpholino

MO1-h2az2b

ID
ZDB-MRPHLNO-180507-2
Name
MO1-h2az2b
Previous Names
  • MO1-h2afvb
Target
Sequence
5' - CTTTTCCTGCTTTGCCTCCTGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-h2az2b
No data available
Phenotype
Phenotype resulting from MO1-h2az2b
Phenotype Fish Figures
caudal fin absent, abnormal WT + MO1-h2az2b Fig. 2 with image from Madakashira et al., 2017
eye absent, abnormal WT + MO1-h2az2b Fig. 2 with image from Madakashira et al., 2017
head necrotic, abnormal WT + MO1-h2az2b Fig. 2 with image from Madakashira et al., 2017
hindbrain decreased height, abnormal WT + MO1-h2az2b Fig. 2 with image from Madakashira et al., 2017
macromolecule methylation increased occurrence, abnormal WT + MO1-h2az2b Fig. 3,  Fig. 5 with image from Madakashira et al., 2017
midbrain hindbrain boundary absent, abnormal WT + MO1-h2az2b Fig. 2 with image from Madakashira et al., 2017
somite decreased amount, abnormal WT + MO1-h2az2b Fig. 2 with image from Madakashira et al., 2017
whole organism Ab1-h2afva labeling decreased amount, abnormal WT + MO1-h2az2b Fig. 1 with image,  Fig. 5 with image from Madakashira et al., 2017
whole organism decreased length, abnormal WT + MO1-h2az2b Fig. 2 with image from Madakashira et al., 2017
whole organism decreased life span, abnormal WT + MO1-h2az2b Fig. 1 with image,  Fig. 5 with image from Madakashira et al., 2017
whole organism morphology, abnormal WT + MO1-h2az2b Fig. 2 with image,  Fig. 5 with image from Madakashira et al., 2017
whole organism 5-methylcytosine increased amount, abnormal WT + MO1-h2az2b Fig. 5 with image from Madakashira et al., 2017
Phenotype of all Fish created by or utilizing MO1-h2az2b
Phenotype Fish Conditions Figures
somite decreased amount, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
whole organism 5-methylcytosine increased amount, abnormal WT + MO1-h2az2b standard conditions Fig. 5 with image from Madakashira et al., 2017
macromolecule methylation increased occurrence, abnormal WT + MO1-h2az2b standard conditions Fig. 3,  Fig. 5 with image from Madakashira et al., 2017
caudal fin absent, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
whole organism decreased length, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
whole organism Ab1-h2afva labeling decreased amount, abnormal WT + MO1-h2az2b standard conditions Fig. 1 with image,  Fig. 5 with image from Madakashira et al., 2017
midbrain hindbrain boundary absent, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
eye absent, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
hindbrain decreased height, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
head necrotic, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image from Madakashira et al., 2017
whole organism decreased life span, abnormal WT + MO1-h2az2b standard conditions Fig. 1 with image,  Fig. 5 with image from Madakashira et al., 2017
whole organism morphology, abnormal WT + MO1-h2az2b standard conditions Fig. 2 with image,  Fig. 5 with image from Madakashira et al., 2017
whole organism 5-methylcytosine increased amount, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism Ab1-h2afva labeling decreased amount, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism morphology, ameliorated WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism decreased life span, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
macromolecule methylation increased occurrence, abnormal WT + MO1-h2az2b + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.