Morpholino

MO1-cdkn2aip

ID
ZDB-MRPHLNO-180124-1
Name
MO1-cdkn2aip
Previous Names
None
Target
Sequence
5' - CCTCTTCTTGCCGCCATCACTCTAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdkn2aip
No data available
Phenotype
Phenotype resulting from MO1-cdkn2aip
Phenotype of all Fish created by or utilizing MO1-cdkn2aip
Phenotype Fish Conditions Figures
presumptive ventral mesoderm cdx4 expression decreased amount, abnormal TU + MO1-cdkn2aip control Fig. 4 with image from He et al., 2017
hematopoietic stem cell myb expression decreased amount, abnormal TU + MO1-cdkn2aip control Fig. 5 with image from He et al., 2017
canonical Wnt signaling pathway decreased process quality, abnormal TU + MO1-cdkn2aip control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm tbx6 expression decreased amount, abnormal TU + MO1-cdkn2aip control Fig. 4 with image from He et al., 2017
definitive hemopoiesis decreased occurrence, abnormal TU + MO1-cdkn2aip control Fig. 5 with image from He et al., 2017
canonical Wnt signaling pathway decreased process quality, abnormal ia4Tg + MO1-cdkn2aip control Fig. 4 with image from He et al., 2017
whole organism GFP expression decreased amount, abnormal ia4Tg + MO1-cdkn2aip control Fig. 4 with image from He et al., 2017
definitive hemopoiesis decreased occurrence, abnormal tp53zdf1/zdf1 + MO1-cdkn2aip control Fig. 5 with image from He et al., 2017
hematopoietic stem cell myb expression decreased amount, abnormal tp53zdf1/zdf1 + MO1-cdkn2aip control Fig. 5 with image from He et al., 2017
canonical Wnt signaling pathway decreased process quality, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm cdx4 expression decreased amount, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm tbx6 expression decreased amount, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm cdx4 expression decreased amount, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
canonical Wnt signaling pathway decreased process quality, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm tbx6 expression decreased amount, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal y206Tg; zf169Tg + MO1-cdkn2aip control Fig. 5 with image from He et al., 2017
Citations