Morpholino

MO1-coasy

ID
ZDB-MRPHLNO-171219-1
Name
MO1-coasy
Previous Names
None
Target
Sequence
5' - ACCACCTGAACATAGACATACAGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-coasy
No data available
Phenotype
Phenotype resulting from MO1-coasy
Phenotype Fish Figures
anal fin decreased size, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
anal fin hypoplastic, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
anatomical structure EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
BMP signaling pathway decreased process quality, abnormal sd2Tg; y1Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
brain morphology, abnormal AB + MO1-coasy Fig. 4 with image from Khatri et al., 2016
brain cell death increased process quality, abnormal AB + MO1-coasy Fig. S10 with image from Khatri et al., 2016
brain development process quality, abnormal AB + MO1-coasy Fig. 2 with image from Khatri et al., 2016
diencephalon neurog1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
diencephalon gata2a expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
eye EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
head edematous, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
head development disrupted, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
hindbrain gata2a expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
hindbrain neurog1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
hindbrain morphology, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
intersegmental vessel hypoplastic, abnormal sd2Tg; y1Tg + MO1-coasy Fig. 6 with image from Khatri et al., 2016
lateral line ganglion neurod1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 4 with image from Khatri et al., 2016
midbrain morphology, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
midbrain hindbrain boundary neurod1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 4 with image from Khatri et al., 2016
midbrain hindbrain boundary neural rod pax2a expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
notochord tbxta expression decreased distribution, abnormal AB + MO1-coasy Fig. 7 with image from Khatri et al., 2016
nucleate erythrocyte decreased amount, abnormal sd2Tg; y1Tg + MO1-coasy Fig. 6 with image from Khatri et al., 2016
post-vent region curved, abnormal AB + MO1-coasy Fig. 1 with imageFig. 2 with image from Khatri et al., 2016
post-vent region edematous, abnormal AB + MO1-coasy Fig. 1 with imageFig. 2 with image from Khatri et al., 2016
post-vent region kinked, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
post-vent region morphology, abnormal AB + MO1-coasy Fig. 4 with image from Khatri et al., 2016
post-vent region cell death increased process quality, abnormal AB + MO1-coasy Fig. S10 with image from Khatri et al., 2016
segmental plate myod1 expression spatial pattern, abnormal AB + MO1-coasy Fig. 7 with image from Khatri et al., 2016
somite EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
somite shape, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
somite border structure, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
somite development process quality, abnormal AB + MO1-coasy Fig. 2 with image from Khatri et al., 2016
spinal cord neuron neurog1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
tail bud tbxta expression decreased distribution, abnormal AB + MO1-coasy Fig. 7 with image from Khatri et al., 2016
tegmentum neurog1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
telencephalon neurog1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
telencephalon neurod1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 4 with image from Khatri et al., 2016
trunk decreased thickness, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
vasculature development disrupted, abnormal sd2Tg; y1Tg + MO1-coasy Fig. 6 with image from Khatri et al., 2016
vasculature development process quality, abnormal sd2Tg; y1Tg + MO1-coasy Fig. 6 with image from Khatri et al., 2016
whole organism bmpr1aa expression decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism bmpr2a expression decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ab expression decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism Ab3-smad5 labeling decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1bb expression decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ba expression decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism wholly dorsalized, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
yolk increased size, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
Phenotype of all Fish created by or utilizing MO1-coasy
Phenotype Fish Conditions Figures
yolk increased size, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
trunk decreased thickness, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
lateral line ganglion neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 4 with image from Khatri et al., 2016
telencephalon neurog1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
spinal cord neuron neurog1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
hindbrain neurog1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
head edematous, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
brain morphology, ameliorated AB + MO1-coasy chemical treatment by injection: coenzyme A Fig. 4 with image from Khatri et al., 2016
hindbrain gata2a expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
brain cell death increased process quality, abnormal AB + MO1-coasy control Fig. S10 with image from Khatri et al., 2016
post-vent region morphology, abnormal AB + MO1-coasy standard conditions Fig. 4 with image from Khatri et al., 2016
brain morphology, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 4 with image from Khatri et al., 2016
telencephalon neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by injection: coenzyme A Fig. 4 with image from Khatri et al., 2016
post-vent region morphology, abnormal AB + MO1-coasy chemical treatment by injection: coenzyme A Fig. 4 with image from Khatri et al., 2016
post-vent region curved, abnormal AB + MO1-coasy standard conditions Fig. 1 with imageFig. 2 with image from Khatri et al., 2016
lateral line ganglion neurod1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 4 with image from Khatri et al., 2016
somite development process quality, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 2 with image from Khatri et al., 2016
lateral line ganglion neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by injection: coenzyme A Fig. 4 with image from Khatri et al., 2016
tail bud tbxta expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 7 with image from Khatri et al., 2016
diencephalon neurog1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
post-vent region morphology, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 2 with imageFig. 4 with image from Khatri et al., 2016
midbrain morphology, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
midbrain hindbrain boundary neurod1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 4 with image from Khatri et al., 2016
tail bud tbxta expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 7 with image from Khatri et al., 2016
brain development process quality, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 2 with image from Khatri et al., 2016
tegmentum neurog1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
somite border structure, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
anal fin decreased size, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
notochord tbxta expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 7 with image from Khatri et al., 2016
midbrain hindbrain boundary neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by injection: coenzyme A Fig. 4 with image from Khatri et al., 2016
diencephalon gata2a expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
telencephalon neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 4 with image from Khatri et al., 2016
telencephalon neurod1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 4 with image from Khatri et al., 2016
post-vent region cell death increased process quality, abnormal AB + MO1-coasy control Fig. S10 with image from Khatri et al., 2016
segmental plate myod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 7 with image from Khatri et al., 2016
post-vent region kinked, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
brain development process quality, abnormal AB + MO1-coasy standard conditions Fig. 2 with image from Khatri et al., 2016
post-vent region edematous, abnormal AB + MO1-coasy standard conditions Fig. 1 with imageFig. 2 with image from Khatri et al., 2016
midbrain hindbrain boundary neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 4 with image from Khatri et al., 2016
segmental plate myod1 expression spatial pattern, abnormal AB + MO1-coasy standard conditions Fig. 7 with image from Khatri et al., 2016
midbrain hindbrain boundary neural rod pax2a expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
whole organism wholly dorsalized, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
somite shape, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
hindbrain morphology, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
notochord tbxta expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 7 with image from Khatri et al., 2016
somite development process quality, abnormal AB + MO1-coasy standard conditions Fig. 2 with image from Khatri et al., 2016
head development disrupted, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
brain morphology, abnormal AB + MO1-coasy standard conditions Fig. 4 with image from Khatri et al., 2016
anal fin hypoplastic, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
anatomical structure EGFP expression spatial pattern, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1aa expression decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
somite EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ab expression decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1bb expression decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
anatomical structure EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ab expression amount, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1bb expression amount, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
eye EGFP expression spatial pattern, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
whole organism Ab3-smad5 labeling decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism bmpr2a expression amount, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
whole organism bmpr2a expression decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ba expression decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism Ab3-smad5 labeling amount, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
somite EGFP expression spatial pattern, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ba expression amount, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
eye EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
BMP signaling pathway process quality, ameliorated sd2Tg; y1Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
vasculature development process quality, ameliorated sd2Tg; y1Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 6 with image from Khatri et al., 2016
intersegmental vessel physical object quality, ameliorated sd2Tg; y1Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 6 with image from Khatri et al., 2016
nucleate erythrocyte decreased amount, abnormal sd2Tg; y1Tg + MO1-coasy standard conditions Fig. 6 with image from Khatri et al., 2016
vasculature development process quality, abnormal sd2Tg; y1Tg + MO1-coasy standard conditions Fig. 6 with image from Khatri et al., 2016
BMP signaling pathway decreased process quality, abnormal sd2Tg; y1Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
vasculature development disrupted, abnormal sd2Tg; y1Tg + MO1-coasy standard conditions Fig. 6 with image from Khatri et al., 2016
intersegmental vessel hypoplastic, abnormal sd2Tg; y1Tg + MO1-coasy standard conditions Fig. 6 with image from Khatri et al., 2016
Citations