Morpholino

MO2-golgb1

ID
ZDB-MRPHLNO-171019-1
Name
MO2-golgb1
Previous Names
  • E14 MO (1)
Target
Sequence
5' - CTGTTCCAGCTACTTATTGAAAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The author verified the sequence of this MO though it does not match the current build.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-golgb1
No data available
Phenotype
Phenotype resulting from MO2-golgb1
Phenotype Fish Figures
brain edematous, abnormal WT + MO2-golgb1 + MO4-tp53 Fig. 1 with image from Bergen et al., 2017
ciliated olfactory receptor neuron 9+2 non-motile cilium malformed, abnormal WT + MO2-golgb1 Fig. 4 with image from Bergen et al., 2017
determination of heart left/right asymmetry decreased process quality, abnormal twu34Tg + MO2-golgb1 Fig. 5 with image from Bergen et al., 2017
ependymal cell cilium increased length, abnormal WT + MO2-golgb1 Fig. 2 with image from Bergen et al., 2017
eye decreased size, abnormal WT + MO2-golgb1 Fig. 1 with image,  Fig. 5 with image from Bergen et al., 2017
heart edematous, abnormal WT + MO2-golgb1 + MO4-tp53 Fig. 1 with image,  Fig. 5 with image from Bergen et al., 2017
heart tube mislocalised, abnormal twu34Tg + MO2-golgb1 Fig. 5 with image from Bergen et al., 2017
myotome cilium assembly process quality, abnormal hsc5Tg + MO2-golgb1 Fig. 2 with image from Bergen et al., 2017
myotome non-motile cilium increased length, abnormal hsc5Tg + MO2-golgb1 Fig. 2 with image from Bergen et al., 2017
neural tube has fewer parts of type neural tube cilium, abnormal WT + MO2-golgb1 Fig. 2 with image from Bergen et al., 2017
neural tube cilium increased length, abnormal WT + MO2-golgb1 Fig. 2 with image from Bergen et al., 2017
neural tube cilium assembly process quality, abnormal WT + MO2-golgb1 Fig. 2 with image from Bergen et al., 2017
olfactory pit cilium assembly process quality, abnormal WT + MO2-golgb1 Fig. 4 with image from Bergen et al., 2017
post-vent region kinked, abnormal WT + MO2-golgb1 Fig. 1 with image from Bergen et al., 2017
whole organism decreased length, abnormal WT + MO2-golgb1 Fig. 5 with image from Bergen et al., 2017
Phenotype of all Fish created by or utilizing MO2-golgb1
Phenotype Fish Conditions Figures
neural tube cilium increased length, abnormal WT + MO2-golgb1 standard conditions Fig. 2 with image from Bergen et al., 2017
whole organism decreased length, abnormal WT + MO2-golgb1 standard conditions Fig. 5 with image from Bergen et al., 2017
eye decreased size, abnormal WT + MO2-golgb1 standard conditions Fig. 1 with image,  Fig. 5 with image from Bergen et al., 2017
brain edematous, abnormal WT + MO2-golgb1 standard conditions Fig. 1 with image from Bergen et al., 2017
ependymal cell cilium increased length, abnormal WT + MO2-golgb1 standard conditions Fig. 2 with image from Bergen et al., 2017
olfactory pit cilium assembly process quality, abnormal WT + MO2-golgb1 standard conditions Fig. 4 with image from Bergen et al., 2017
heart edematous, abnormal WT + MO2-golgb1 standard conditions Fig. 1 with image,  Fig. 5 with image from Bergen et al., 2017
neural tube cilium assembly process quality, abnormal WT + MO2-golgb1 standard conditions Fig. 2 with image from Bergen et al., 2017
post-vent region kinked, abnormal WT + MO2-golgb1 standard conditions Fig. 1 with image from Bergen et al., 2017
neural tube has fewer parts of type neural tube cilium, abnormal WT + MO2-golgb1 standard conditions Fig. 2 with image from Bergen et al., 2017
ciliated olfactory receptor neuron 9+2 non-motile cilium malformed, abnormal WT + MO2-golgb1 standard conditions Fig. 4 with image from Bergen et al., 2017
post-vent region kinked, abnormal WT + MO2-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
heart edematous, abnormal WT + MO2-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
brain edematous, abnormal WT + MO2-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
eye decreased size, abnormal WT + MO2-golgb1 + MO4-tp53 standard conditions Fig. 1 with image from Bergen et al., 2017
myotome cilium assembly process quality, abnormal hsc5Tg + MO2-golgb1 standard conditions Fig. 2 with image from Bergen et al., 2017
myotome non-motile cilium increased length, abnormal hsc5Tg + MO2-golgb1 standard conditions Fig. 2 with image from Bergen et al., 2017
determination of heart left/right asymmetry decreased process quality, abnormal twu34Tg + MO2-golgb1 standard conditions Fig. 5 with image from Bergen et al., 2017
heart tube mislocalised, abnormal twu34Tg + MO2-golgb1 standard conditions Fig. 5 with image from Bergen et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.