Morpholino
MO1-gbp4
- ID
- ZDB-MRPHLNO-170915-6
- Name
- MO1-gbp4
- Previous Names
- None
- Target
- Sequence
-
5' - GCTGTTTGTGTGTCTCTAACCTGTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gbp4
No data available
Phenotype
Phenotype resulting from MO1-gbp4
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-gbp4
1 - 5 of 18 Show all
Citations
- Tyrkalska, S.D., Pérez-Oliva, A.B., Rodríguez-Ruiz, L., Martínez-Morcillo, F.J., Alcaraz-Pérez, F., Martínez-Navarro, F.J., Lachaud, C., Ahmed, N., Schroeder, T., Pardo-Sánchez, I., Candel, S., López-Muñoz, A., Choudhuri, A., Rossmann, M.P., Zon, L.I., Cayuela, M.L., García-Moreno, D., Mulero, V. (2019) Inflammasome Regulates Hematopoiesis through Cleavage of the Master Erythroid Transcription Factor GATA1. Immunity. 51(1):50-63.e5
- Valera-Pérez, A., Tyrkalska, S.D., Viana, C., Rojas-Fernández, A., Pelegrín, P., García-Moreno, D., Pérez-Oliva, A.B., Mulero, V. (2019) WDR90 is a new component of the NLRC4 inflammasome involved in Salmonella Typhimurium resistance. Developmental and comparative immunology. 100:103428
- Tyrkalska, S.D., Candel, S., Angosto, D., Gómez-Abellán, V., Martín-Sánchez, F., García-Moreno, D., Zapata-Pérez, R., Sánchez-Ferrer, Á., Sepulcre, M.P., Pelegrín, P., Mulero, V. (2016) Neutrophils mediate Salmonella Typhimurium clearance through the GBP4 inflammasome-dependent production of prostaglandins. Nature communications. 7:12077
1 - 3 of 3
Show