Morpholino

MO1-gbp4

ID
ZDB-MRPHLNO-170915-6
Name
MO1-gbp4
Previous Names
None
Target
Sequence
5' - GCTGTTTGTGTGTCTCTAACCTGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gbp4
Phenotype
Phenotype resulting from MO1-gbp4
Phenotype of all Fish created by or utilizing MO1-gbp4
Phenotype Fish Conditions Figures
whole organism decreased life span, exacerbated WT + MO1-gbp4 chemical treatment by environment: prostaglandin J2, bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 9 from Tyrkalska et al., 2016
cysteine-type endopeptidase activity involved in apoptotic process occurrence, ameliorated WT + MO1-gbp4 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2Fig. 4Fig. 5 from Tyrkalska et al., 2016
cysteine-type endopeptidase activity involved in apoptotic process decreased occurrence, abnormal WT + MO1-gbp4 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1Fig. 3 from Tyrkalska et al., 2016
whole organism decreased life span, ameliorated WT + MO1-gbp4 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium, chemical treatment by environment: prostaglandin E2 Fig. 9 from Tyrkalska et al., 2016
whole organism decreased life span, exacerbated WT + MO1-gbp4 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2Fig. 3Fig. 4Fig. 5Fig. 7Fig. 9Fig. S8 with image from Tyrkalska et al., 2016
whole organism Ab4-gbp4 labeling decreased amount, abnormal WT + MO1-gbp4 standard conditions Fig. 1 from Tyrkalska et al., 2016
whole organism Ab3-gbp4 labeling decreased amount, abnormal WT + MO1-gbp4 standard conditions Fig. 1 from Tyrkalska et al., 2016
whole organism decreased life span, exacerbated WT + MO1-gbp4 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium, chemical treatment by environment: 15-deoxy-Delta(12,14)-prostaglandin J2 Fig. 9 from Tyrkalska et al., 2016
whole organism Ab2-gbp4 labeling decreased amount, abnormal WT + MO1-gbp4 standard conditions Fig. 1 from Tyrkalska et al., 2016
whole organism Ab1-gbp4 labeling decreased amount, abnormal WT + MO1-gbp4 standard conditions Fig. 1 from Tyrkalska et al., 2016
cysteine-type endopeptidase activity involved in apoptotic process decreased occurrence, abnormal WT + MO1-gbp4 control Fig. 2Fig. 3 from Tyrkalska et al., 2016
whole organism decreased life span, ameliorated WT + MO1-gbp4 chemical treatment by environment: prostaglandin D2, bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 9 from Tyrkalska et al., 2016
cysteine-type endopeptidase activity involved in apoptotic process decreased occurrence, abnormal i114Tg + MO1-gbp4 control Fig. 1 from Tyrkalska et al., 2019
neutrophil decreased amount, abnormal i114Tg + MO1-gbp4 control Fig. 1 from Tyrkalska et al., 2019
Fig. S8 with image from Tyrkalska et al., 2016
whole organism decreased life span, ameliorated sh267Tg ; ums2Tg + MO1-gbp4 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 7 from Tyrkalska et al., 2016
whole organism gata1a expression increased amount, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-gbp4 control Fig. 4 from Tyrkalska et al., 2019
whole organism spi1b expression decreased amount, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-gbp4 control Fig. 4 from Tyrkalska et al., 2019
whole organism Ab2-gata1a labeling increased amount, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-gbp4 control Fig. 4 from Tyrkalska et al., 2019
Citations