Morpholino

MO3-mir206-2

ID
ZDB-MRPHLNO-170907-2
Name
MO3-mir206-2
Previous Names
None
Target
Sequence
5' - GATCTCACTGAAGCCACACACTTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mir206-2
Expressed Gene Anatomy Figures
cxcr4a Fig. 5 with image from Lin et al., 2017
rtn4a Fig. 2 with image from Lin et al., 2017
sars1 Fig. 1 from Lin et al., 2013
thbs3a Fig. 5 with image from Lin et al., 2017
vegfaa Fig. 2 from Lin et al., 2013
Phenotype
Phenotype resulting from MO3-mir206-2
Phenotype Fish Figures
CaP motoneuron neuron projection morphology, abnormal ml2Tg + MO3-mir206-2 Fig. 1 from Lin et al., 2018
CaP motoneuron neuron projection extension arrested, abnormal ml2Tg + MO3-mir206-2 Fig. 1 from Lin et al., 2018
intersegmental vessel increased branchiness, abnormal y7Tg + MO3-mir206-2 Fig. 2 from Lin et al., 2013
intersegmental vessel endothelial cell increased amount, abnormal y7Tg + MO3-mir206-2 Fig. 2,  Fig. S6 from Lin et al., 2013
somite cxcr4a expression decreased amount, abnormal AB + MO3-mir206-2 Fig. 5 with image from Lin et al., 2017
somite cxcr4a expression decreased distribution, abnormal AB + MO3-mir206-2 Fig. 5 with image from Lin et al., 2017
somite thbs3a expression increased amount, abnormal AB + MO3-mir206-2 Fig. 5 with image from Lin et al., 2017
somite thbs3a expression increased distribution, abnormal AB + MO3-mir206-2 Fig. 5 with image from Lin et al., 2017
somite border malformed, abnormal AB + MO3-mir206-2 Fig. 4 with image from Lin et al., 2017
somite border morphology, abnormal AB + MO3-mir206-2 Fig. 4 with image,  Fig. 5 with image from Lin et al., 2017
somite border actin filament malformed, abnormal AB + MO3-mir206-2 Fig. 2 with image from Lin et al., 2017
somite border actin filament morphology, abnormal AB + MO3-mir206-2 Fig. 2 with image from Lin et al., 2017
somite border centrosome spatial pattern, abnormal AB + MO3-mir206-2 Fig. 6 with image from Lin et al., 2017
somite border epithelial cell morphology, abnormal AB + MO3-mir206-2 Fig. 6 with image from Lin et al., 2017
somite border mesenchymal to epithelial transition decreased occurrence, abnormal AB + MO3-mir206-2 Fig. 6 with image from Lin et al., 2017
whole organism cxcr4a expression decreased amount, abnormal AB + MO3-mir206-2 Fig. 5 with image from Lin et al., 2017
whole organism rtn4a expression increased amount, abnormal AB + MO3-mir206-2 Fig. 2 with image from Lin et al., 2017
whole organism thbs3a expression increased amount, abnormal AB + MO3-mir206-2 Fig. 5 with image from Lin et al., 2017
whole organism vegfaa expression increased amount, abnormal WT + MO3-mir206-2 Fig. 2 from Lin et al., 2013
Phenotype of all Fish created by or utilizing MO3-mir206-2
Phenotype Fish Conditions Figures
somite border malformed, abnormal AB + MO3-mir206-2 standard conditions Fig. 4 with image from Lin et al., 2017
somite cxcr4a expression decreased amount, abnormal AB + MO3-mir206-2 standard conditions Fig. 5 with image from Lin et al., 2017
somite border centrosome spatial pattern, abnormal AB + MO3-mir206-2 standard conditions Fig. 6 with image from Lin et al., 2017
somite cxcr4a expression decreased distribution, abnormal AB + MO3-mir206-2 standard conditions Fig. 5 with image from Lin et al., 2017
whole organism rtn4a expression increased amount, abnormal AB + MO3-mir206-2 standard conditions Fig. 2 with image from Lin et al., 2017
whole organism cxcr4a expression decreased amount, abnormal AB + MO3-mir206-2 standard conditions Fig. 5 with image from Lin et al., 2017
somite border actin filament malformed, abnormal AB + MO3-mir206-2 standard conditions Fig. 2 with image from Lin et al., 2017
somite border morphology, abnormal AB + MO3-mir206-2 standard conditions Fig. 4 with image,  Fig. 5 with image from Lin et al., 2017
somite thbs3a expression increased distribution, abnormal AB + MO3-mir206-2 standard conditions Fig. 5 with image from Lin et al., 2017
somite border epithelial cell morphology, abnormal AB + MO3-mir206-2 standard conditions Fig. 6 with image from Lin et al., 2017
somite thbs3a expression increased amount, abnormal AB + MO3-mir206-2 standard conditions Fig. 5 with image from Lin et al., 2017
whole organism thbs3a expression increased amount, abnormal AB + MO3-mir206-2 standard conditions Fig. 5 with image from Lin et al., 2017
somite border actin filament morphology, abnormal AB + MO3-mir206-2 standard conditions Fig. 2 with image from Lin et al., 2017
somite border mesenchymal to epithelial transition decreased occurrence, abnormal AB + MO3-mir206-2 standard conditions Fig. 6 with image from Lin et al., 2017
whole organism vegfaa expression increased amount, abnormal WT + MO3-mir206-2 standard conditions Fig. 2 from Lin et al., 2013
CaP motoneuron neuron projection extension arrested, abnormal ml2Tg + MO3-mir206-2 standard conditions Fig. 1 from Lin et al., 2018
CaP motoneuron neuron projection morphology, abnormal ml2Tg + MO3-mir206-2 standard conditions Fig. 1 from Lin et al., 2018
intersegmental vessel endothelial cell increased amount, abnormal y7Tg + MO3-mir206-2 standard conditions Fig. 2,  Fig. S6 from Lin et al., 2013
intersegmental vessel increased branchiness, abnormal y7Tg + MO3-mir206-2 standard conditions Fig. 2 from Lin et al., 2013
somite border morphology, ameliorated AB + MO1-thbs3a + MO3-mir206-2 standard conditions Fig. 5 with image from Lin et al., 2017
whole organism thbs3a expression increased amount, abnormal AB + MO2-cxcr4a + MO3-mir206-2 standard conditions Fig. 5 with image from Lin et al., 2017
intersegmental vessel endothelial cell increased amount, abnormal y7Tg + MO3-mir1-1,mir1-2 + MO3-mir206-2 standard conditions Fig. 2 from Lin et al., 2013
intersegmental vessel increased branchiness, abnormal y7Tg + MO3-mir1-1,mir1-2 + MO3-mir206-2 standard conditions Fig. 2 from Lin et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.