Morpholino

MO1-lurap1

ID

ZDB-MRPHLNO-170817-2

Name

MO1-lurap1

Previous Names

None

Target

lurap1 (1)

Sequence

5' - CACAGGTATTATTACTCTCCTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lurap1

No data available

Phenotype

Phenotype resulting from MO1-lurap1

Phenotype	Fish	Figures
fast muscle cell disorganized, abnormal	WT + MO1-lurap1	Fig. S4 from Cao et al., 2016
muscle cell disorganized, abnormal	WT + MO1-lurap1	Fig. 3 , Fig. 4 , Fig. S2 from Cao et al., 2016
slow muscle cell disorganized, abnormal	WT + MO1-lurap1	Fig. 4 from Cao et al., 2016
slow muscle cell ab-f59 labeling spatial pattern, abnormal	WT + MO1-lurap1	Fig. 4 from Cao et al., 2016
somite disorganized, abnormal	WT + MO1-lurap1	Fig. 3 from Cao et al., 2016
somite sarcomere absent, abnormal	WT + MO1-lurap1	Fig. S2 from Cao et al., 2016
somite border ab1-dmd labeling spatial pattern, abnormal	WT + MO1-lurap1	Fig. 4 from Cao et al., 2016
vertical myoseptum disorganized, abnormal	WT + MO1-lurap1	Fig. S2 from Cao et al., 2016
vertical myoseptum morphology, abnormal	WT + MO1-lurap1	Fig. 4 from Cao et al., 2016
whole organism anterior-posterior axis bent, abnormal	WT + MO1-lurap1	Fig. 3 from Cao et al., 2016

Phenotype of all Fish created by or utilizing MO1-lurap1

Phenotype	Fish	Conditions	Figures
muscle cell disorganized, abnormal	WT + MO1-lurap1	standard conditions	Fig. 3 , Fig. 4 , Fig. S2 from Cao et al., 2016
fast muscle cell disorganized, abnormal	WT + MO1-lurap1	standard conditions	Fig. S4 from Cao et al., 2016
vertical myoseptum disorganized, abnormal	WT + MO1-lurap1	standard conditions	Fig. S2 from Cao et al., 2016
myoblast cell-matrix adhesion arrested, abnormal	WT + MO1-lurap1	primary cell culture: somite	Fig. 6 from Cao et al., 2016
slow muscle cell disorganized, abnormal	WT + MO1-lurap1	standard conditions	Fig. 4 from Cao et al., 2016
myoblast cell-matrix adhesion decreased occurrence, abnormal	WT + MO1-lurap1	primary cell culture: somite	Fig. 6 from Cao et al., 2016
myoblast Golgi apparatus morphology, abnormal	WT + MO1-lurap1	primary cell culture: somite	Fig. 7 from Cao et al., 2016
somite disorganized, abnormal	WT + MO1-lurap1	standard conditions	Fig. 3 from Cao et al., 2016
whole organism anterior-posterior axis bent, abnormal	WT + MO1-lurap1	standard conditions	Fig. 3 from Cao et al., 2016
vertical myoseptum morphology, abnormal	WT + MO1-lurap1	standard conditions	Fig. 4 from Cao et al., 2016
slow muscle cell ab-f59 labeling spatial pattern, abnormal	WT + MO1-lurap1	standard conditions	Fig. 4 from Cao et al., 2016
somite border ab1-dmd labeling spatial pattern, abnormal	WT + MO1-lurap1	standard conditions	Fig. 4 from Cao et al., 2016
somite sarcomere absent, abnormal	WT + MO1-lurap1	standard conditions	Fig. S2 from Cao et al., 2016
somite border ab1-dmd labeling spatial pattern, abnormal	WT + MO1-lurap1 + MO1-myo18ab	standard conditions	Fig. 4 from Cao et al., 2016
muscle cell disorganized, exacerbated	WT + MO1-lurap1 + MO1-myo18ab	standard conditions	Fig. 4 from Cao et al., 2016
slow muscle cell ab-f59 labeling spatial pattern, abnormal	WT + MO1-lurap1 + MO1-myo18ab	standard conditions	Fig. 4 from Cao et al., 2016
slow muscle cell disorganized, exacerbated	WT + MO1-lurap1 + MO1-myo18ab	standard conditions	Fig. 4 from Cao et al., 2016
vertical myoseptum morphology, exacerbated	WT + MO1-lurap1 + MO1-myo18ab	standard conditions	Fig. 4 from Cao et al., 2016

Citations