Morpholino

MO8-nrg1

ID

ZDB-MRPHLNO-170808-3

Name

MO8-nrg1

Previous Names

None

Target

nrg1 (1)

Sequence

5' - CTTTGCCTGCTTTCACCTCAGCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO8-nrg1

No data available

Phenotype

Phenotype resulting from MO8-nrg1

Phenotype	Fish	Figures
caudal fin kinked, abnormal	AB + MO8-nrg1	Fig. 2 from Pu et al., 2017
cranial nerve X morphology, abnormal	AB + MO8-nrg1	Fig. 5 from Pu et al., 2017
embryo development disrupted, abnormal	AB + MO8-nrg1	Fig. 2 from Pu et al., 2017
enteric nervous system crestin expression decreased amount, abnormal	AB + MO8-nrg1	Fig. 4 from Pu et al., 2017
enteric nervous system ret expression decreased amount, abnormal	AB + MO8-nrg1	Fig. 4 from Pu et al., 2017
enteric nervous system sox10 expression decreased amount, abnormal	AB + MO8-nrg1	Fig. 4 from Pu et al., 2017
enteric neuron decreased amount, abnormal	AB + MO8-nrg1	Fig. 3 from Pu et al., 2017
head decreased size, abnormal	AB + MO8-nrg1	Fig. 2 from Pu et al., 2017
intestine neuron projection disorganized, abnormal	AB + MO8-nrg1	Fig. 5 from Pu et al., 2017
intestine neuron projection increased thickness, abnormal	AB + MO8-nrg1	Fig. 5 from Pu et al., 2017
intestine neuron projection shortened, abnormal	AB + MO8-nrg1	Fig. 5 from Pu et al., 2017
pericardium edematous, abnormal	AB + MO8-nrg1	Fig. 2 from Pu et al., 2017
whole organism decreased life span, abnormal	AB + MO8-nrg1	Fig. 2 from Pu et al., 2017
whole organism morphology, abnormal	AB + MO8-nrg1	Fig. 2 from Pu et al., 2017

Phenotype of all Fish created by or utilizing MO8-nrg1

Phenotype	Fish	Conditions	Figures
enteric nervous system ret expression decreased amount, abnormal	AB + MO8-nrg1	standard conditions	Fig. 4 from Pu et al., 2017
intestine neuron projection disorganized, abnormal	AB + MO8-nrg1	standard conditions	Fig. 5 from Pu et al., 2017
intestine neuron projection shortened, abnormal	AB + MO8-nrg1	standard conditions	Fig. 5 from Pu et al., 2017
pericardium edematous, abnormal	AB + MO8-nrg1	standard conditions	Fig. 2 from Pu et al., 2017
enteric nervous system sox10 expression decreased amount, abnormal	AB + MO8-nrg1	standard conditions	Fig. 4 from Pu et al., 2017
caudal fin kinked, abnormal	AB + MO8-nrg1	standard conditions	Fig. 2 from Pu et al., 2017
enteric nervous system crestin expression decreased amount, abnormal	AB + MO8-nrg1	standard conditions	Fig. 4 from Pu et al., 2017
cranial nerve X morphology, abnormal	AB + MO8-nrg1	standard conditions	Fig. 5 from Pu et al., 2017
whole organism morphology, abnormal	AB + MO8-nrg1	standard conditions	Fig. 2 from Pu et al., 2017
whole organism decreased life span, abnormal	AB + MO8-nrg1	standard conditions	Fig. 2 from Pu et al., 2017
intestine neuron projection increased thickness, abnormal	AB + MO8-nrg1	standard conditions	Fig. 5 from Pu et al., 2017
embryo development disrupted, abnormal	AB + MO8-nrg1	standard conditions	Fig. 2 from Pu et al., 2017
enteric neuron decreased amount, abnormal	AB + MO8-nrg1	standard conditions	Fig. 3 from Pu et al., 2017
head decreased size, abnormal	AB + MO8-nrg1	standard conditions	Fig. 2 from Pu et al., 2017

Citations