Morpholino

MO1-gpatch3

ID
ZDB-MRPHLNO-170725-1
Name
MO1-gpatch3
Previous Names
  • gpatch3 ATG (1)
  • MO-gpatch3
Target
Sequence
5' - GCCGCCATACTGGAGTCTGTGTAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gpatch3
No data available
Phenotype
Phenotype resulting from MO1-gpatch3
Phenotype Fish Figures
anterior segment eye edematous, abnormal TU + MO1-gpatch3 Fig. 8 with imageFig. 9 with image from Ferre-Fernández et al., 2017
brain decreased size, abnormal TU + MO1-gpatch3 Fig. 7 with image from Ferre-Fernández et al., 2017
camera-type eye development disrupted, abnormal TU + MO1-gpatch3 Fig. 8 with image from Ferre-Fernández et al., 2017
ceratobranchial cartilage absent, abnormal TU + MO1-gpatch3 Fig. S9 with image from Ferre-Fernández et al., 2017
ceratohyal cartilage absent, abnormal TU + MO1-gpatch3 Fig. S9 with image from Ferre-Fernández et al., 2017
chondrocranium cartilage hypoplastic, abnormal TU + MO1-gpatch3 Fig. S9 with image from Ferre-Fernández et al., 2017
cranium morphology, abnormal TU + MO1-gpatch3 Fig. 7 with image from Ferre-Fernández et al., 2017
ethmoid cartilage decreased size, abnormal TU + MO1-gpatch3 Fig. S9 with image from Ferre-Fernández et al., 2017
eye decreased size, abnormal TU + MO1-gpatch3 Fig. 7 with imageFig. 8 with imageFig. 9 with imageFig. S6 with image from Ferre-Fernández et al., 2017
eye morphology, abnormal TU + MO1-gpatch3 Fig. 7 with image from Ferre-Fernández et al., 2017
iridophore decreased amount, abnormal TU + MO1-gpatch3 Fig. 8 with image from Ferre-Fernández et al., 2017
mandibular arch skeleton malformed, abnormal TU + MO1-gpatch3 Fig. 7 with imageFig. 8 with imageFig. S6 with image from Ferre-Fernández et al., 2017
Meckel's cartilage dysplastic, abnormal TU + MO1-gpatch3 Fig. S9 with image from Ferre-Fernández et al., 2017
palatoquadrate cartilage dysplastic, abnormal TU + MO1-gpatch3 Fig. S9 with image from Ferre-Fernández et al., 2017
pectoral fin malformed, abnormal TU + MO1-gpatch3 Fig. 9 with imageFig. S6 with image from Ferre-Fernández et al., 2017
pectoral fin cartilage malformed, abnormal TU + MO1-gpatch3 Fig. 7 with image from Ferre-Fernández et al., 2017
pericardium edematous, abnormal TU + MO1-gpatch3 Fig. 7 with image from Ferre-Fernández et al., 2017
pharyngeal arch 3-7 malformed, abnormal TU + MO1-gpatch3 Fig. 7 with image from Ferre-Fernández et al., 2017
pharyngeal arch cartilage malformed, abnormal TU + MO1-gpatch3 Fig. S9 with image from Ferre-Fernández et al., 2017
xanthophore decreased amount, abnormal TU + MO1-gpatch3 Fig. 8 with image from Ferre-Fernández et al., 2017
Phenotype of all Fish created by or utilizing MO1-gpatch3
Phenotype Fish Conditions Figures
ethmoid cartilage decreased size, abnormal TU + MO1-gpatch3 standard conditions Fig. S9 with image from Ferre-Fernández et al., 2017
chondrocranium cartilage hypoplastic, abnormal TU + MO1-gpatch3 standard conditions Fig. S9 with image from Ferre-Fernández et al., 2017
eye decreased size, abnormal TU + MO1-gpatch3 standard conditions Fig. 7 with imageFig. 8 with imageFig. 9 with imageFig. S6 with image from Ferre-Fernández et al., 2017
pectoral fin malformed, abnormal TU + MO1-gpatch3 standard conditions Fig. 9 with imageFig. S6 with image from Ferre-Fernández et al., 2017
ceratohyal cartilage absent, abnormal TU + MO1-gpatch3 standard conditions Fig. S9 with image from Ferre-Fernández et al., 2017
ceratobranchial cartilage absent, abnormal TU + MO1-gpatch3 standard conditions Fig. S9 with image from Ferre-Fernández et al., 2017
mandibular arch skeleton malformed, abnormal TU + MO1-gpatch3 standard conditions Fig. 7 with imageFig. 8 with imageFig. S6 with image from Ferre-Fernández et al., 2017
xanthophore decreased amount, abnormal TU + MO1-gpatch3 standard conditions Fig. 8 with image from Ferre-Fernández et al., 2017
eye morphology, abnormal TU + MO1-gpatch3 standard conditions Fig. 7 with image from Ferre-Fernández et al., 2017
pharyngeal arch 3-7 malformed, abnormal TU + MO1-gpatch3 standard conditions Fig. 7 with image from Ferre-Fernández et al., 2017
cranium morphology, abnormal TU + MO1-gpatch3 standard conditions Fig. 7 with image from Ferre-Fernández et al., 2017
pectoral fin cartilage malformed, abnormal TU + MO1-gpatch3 standard conditions Fig. 7 with image from Ferre-Fernández et al., 2017
camera-type eye development disrupted, abnormal TU + MO1-gpatch3 standard conditions Fig. 8 with image from Ferre-Fernández et al., 2017
anterior segment eye edematous, abnormal TU + MO1-gpatch3 standard conditions Fig. 8 with imageFig. 9 with image from Ferre-Fernández et al., 2017
Meckel's cartilage dysplastic, abnormal TU + MO1-gpatch3 standard conditions Fig. S9 with image from Ferre-Fernández et al., 2017
palatoquadrate cartilage dysplastic, abnormal TU + MO1-gpatch3 standard conditions Fig. S9 with image from Ferre-Fernández et al., 2017
brain decreased size, abnormal TU + MO1-gpatch3 standard conditions Fig. 7 with image from Ferre-Fernández et al., 2017
pharyngeal arch cartilage malformed, abnormal TU + MO1-gpatch3 standard conditions Fig. S9 with image from Ferre-Fernández et al., 2017
pericardium edematous, abnormal TU + MO1-gpatch3 standard conditions Fig. 7 with image from Ferre-Fernández et al., 2017
iridophore decreased amount, abnormal TU + MO1-gpatch3 standard conditions Fig. 8 with image from Ferre-Fernández et al., 2017
Citations