header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-170608-1
Morpholino Name: MO1-eftud2
Target: eftud2 (1)
Sequence:
5' - ACTCGTCATAAAGATCAGTCTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-eftud2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-eftud2
Expressed Gene Anatomy Figures
tp53 Fig. 7 with image from Lei et al., 2017
PHENOTYPE
Phenotype resulting from MO1-eftud2
Phenotype of all Fish created by or utilizing MO1-eftud2
Genome Resources:
CITATIONS (1)